Labshake search
Citations for Thermo Fisher :
2751 - 2800 of 10000+ citations for 7 Methyl 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Cell Biology 2021Quote: Mitochondrial membrane potential was tested using the fluorescent potentiometric compound tetramethylrhodamine methyl ester (TMRM, 20 nM; Invitrogen). Cells were incubated in DMEM without phenol red with 0.1% FBS and CsH (1 µM ...
-
bioRxiv - Biophysics 2019Quote: ... Cleaved peptides were precipitated from ice-cold methyl tert-butyl ether (MTBE; Thermofisher Acros Organics, Geel, Belgium). After washing and collection by centrifugation crude peptides were dissolved in 20% (v/v ...
-
bioRxiv - Biophysics 2019Quote: ... Cleaved peptides were precipitated from ice-cold methyl tert-butyl ether (MTBE; Thermofisher Acros Organics, Geel, Belgium). After washing and collection by centrifugation crude peptides were dissolved in 20% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: B-RBD cells (1 × 107 cells/mL) were combined with 4 μM Fluo-4 AM (Invitrogen, USA, Cat: #F14217) for 20 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... and undigested chromatin were adjusted to 810μl with MCN-digestion buffer with 0.005M EGTA and cross-linked by adding 135 μl of buffered 7 % formaldehyde solution (7 % CH2O, 140 mM Na2HPO4 pH 8.67) using 16 % CH2O methanol-free ampules (Thermo Scientific Cat #28906), to a final concentration of 1 % ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were blocked in 2% goat serum + 2% Bovine Serum Albumin for 2 hours at room temperature before primary antibody (GFP, 1:500, Invitrogen #A6455) was added and the embryos were incubated overnight at 4°C with rocking ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-centrin-3 (1:1000; PA5-35865; Thermo Scientific, Rockford, USA), rabbit anti-acetylated α-tubulin (1:800 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% [w/w] P/S [Gibco] and 1 % [w/w] Glutamax [Gibco]) supplemented with 1 μM TO-PRO®-3 (Thermo Fisher Scientific). After 16 h ...
-
bioRxiv - Immunology 2021Quote: ... 3 μl of a 1:400,000 dilution of ERCC synthetic mRNAs (ThermoFisher) were added and total RNA was isolated using a Quick-RNA MicroPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2022Quote: ... and nuclear dye (TO-PRO-3 Iodide, 1:400, Thermo Fisher T3605) were added to the blocking solution ...
-
bioRxiv - Neuroscience 2022Quote: ... and a 1:400 dilution of TO-PRO-3 (Thermo Fisher T3605) for 24 hr at 4°C in the dark ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Microbiology 2021Quote: ... to a DNA:lipofectamine ratio of 1:3 and 100μl Opti-MEM (Gibco). Cells were collected 24 hours post-transfection ...
-
bioRxiv - Microbiology 2022Quote: Calu-3 cells were maintained in Opti-MEM I (1) + GlutaMAX (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: Calu-3 cells were cultured in Opti-MEM I (1) + GlutaMAX (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Calu-3 cells were cultured in Opti-MEM I (1) + GlutaMAX (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 cells were maintained in Opti-MEM I (1) + GlutaMAX (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... in Retinal Differentiation Media (DMEM/F12 nutrient mix (3:1 ratio, Gibco), 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... After 1–3 h incubation with Alexa Fluor-conjugated secondary antibodies (Invitrogen) followed by DAPI staining (0.1 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... TO-PRO™-3 iodide (Thermo Fisher; #T3605; 1:1,000 in PTwH.) As secondary antibodies donkey anti-rabbit Alexa Fluor® 568 (Thermo Fisher ...
-
bioRxiv - Paleontology 2021Quote: ... and finally stained with 1 μM To-Pro-3(Invitrogen, CA, USA) for 30min ...
-
bioRxiv - Bioengineering 2022Quote: ... was diluted 1:250 in 3% BSA/0.1% tween-20 (Fisher Scientific) and incubated for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin Receptor β CT-3 mouse monoclonal antibody (1:1000, AHR0271, ThermoFisher), Perilipin-1/PLIN1 D1D8 rabbit monoclonal antibody (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... cells were passaged 1:15 every 3 days using trypsin (Gibco, 25300054) and centrifugations at 200 xg ...
-
bioRxiv - Cell Biology 2024Quote: ... and replaced with M2 containing 1 μM TO-PRO-3 iodide (ThermoFisher). A SpectraMax i3X multimode detection platform equipped with a MiniMax cytometer (Molecular Devices ...
-
bioRxiv - Plant Biology 2023Quote: ... and precipitated with 1/10 volume of 3 M Sodium Acetate (Invitrogen), 2 μL GlycoBlue (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... transfection reagent at a ratio of 1:3 DNA:Fugene in optiMEM (Gibco). SARS-2 PV were harvested at 48h post transfection and supernatant filtered through a 0.45 μm acetate cellulose filter (Starlab ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were counterstained with TO-PRO™-3 Iodide (Invitrogen, 1:2000). For immunofluorescence detection of DEK or PCNA cells were fixed with 4% PFA/PBS (20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... + hydrogen peroxidase 3% (1:100, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... and extracted total RNA using BCP (1-bromo-3-chloropropane; Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... mouse anti-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:50000, Thermo Fisher, AM4300), mouse anti-CASQ1 (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... following a 3-hours treatment with 100 ng ml−1 colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were incubated with TO-PRO-3 Iodide (1:1000, Life Technologies) in 1x PBS for 20 minutes and then mounted with VectaShield mounting media (Vector Laboratories) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Synthesized cDNA was diluted 1:3 and QS5 or QS6 (Life Technologies) systems were used for performing RT-qPCR analyses ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained for one minute with 30 ng/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) in 1x PHEM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue nuclei were visualized with nuclear stain 4′,6-diamidino-2-phenylindole (DAPI, 62247; Thermo Fisher Scientific). Coverslips were mounted using Prolong Gold (P36934 ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) was used to stain intracellular DNA (NucBlue, Thermo Fisher, Waltham, MA). Alexa Fluor 647 Phalloidin (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... Sections were stained with DAPI (4′,6′-diamidino-2-phenylindole) and mounted in Prolong Gold (Life Technologies). Images were obtained by confocal microscopy (Nikon C2+ Eclipse ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue was washed in PBS before counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) and mounting ...
-
bioRxiv - Cell Biology 2019Quote: Laurdan (6-dodecanoyl-2-dimethylaminonaphthalene; product D250) and di-4-ANEPPDHQ (product D36802) were purchased from ThermoFisher. Methyl-β-cyclodextrin (product C4555 ...
-
bioRxiv - Microbiology 2019Quote: All samples were counterstained with DAPI (4’,6-diamidino-2-phenylindole; Invitrogen, Fisher Scientific AG, Reinach, Switzerland) to visualize nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... then stained for one minute with 30 ng/mL 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) in 1x PHEM ...
-
bioRxiv - Biochemistry 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Scientific) equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm ...
-
bioRxiv - Biochemistry 2021Quote: ... equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm, 4 μm, Thermo Scientific). The column temperature was held at 30°C ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Scientific) equipped with a Dionex IonPac AS11-HC guard column (2 mm × 50 mm ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... equipped with a Dionex IonPac AS11-HC guard column (2 mm × 50 mm, 4 μm, Thermo Scientific). The column temperature was held at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the slides were incubated in 1μg/ml of 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) at RT for 10min ...
-
bioRxiv - Cell Biology 2021Quote: ... Sections were mounted with ProLong Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies) and imaged using a Leica SP5 DMI (zebrafish sections ...