Labshake search
Citations for Thermo Fisher :
2701 - 2750 of 10000+ citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 500 ng of total RNA was reverse transcribed using the M-MLV RT kit (28025013; Invitrogen). TaqMan Fast Advanced Master Mix (4444557 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Extracted ion chromatograms of the [M+H]+ forms were integrated using Tracefinder software (Thermo Fisher Scientific). For the reported intensity levels of the different amino acids ...
-
bioRxiv - Genomics 2024Quote: ... DNA fragments were then denatured and bound to magnetic streptavidin M-280 beads (Invitrogen cat. 11205D) for 30 minutes at room temperature with nutation ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 M sucrose) on ice and incubated with 1 mg/ml of fluorescein-dextran (Invitrogen, D1823) for 10 minutes at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... 694.0285 and 694.3614 m/z) were summed for quantitative analysis in the Quan Browser program (ThermoFisher). The plasma samples from mothers with heterozygous fetuses were analysed on an M-Class LC system (Waters) ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were rinsed with ice-cold PBS and lysed in M-PER buffer (Thermo Fisher Scientific) containing Halt protease and phosphatase inhibitor cocktail (1X ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the remaining samples were incubated with Dynabeads M-280 streptavidin magnetic beads (Invitrogen, cat # 11206D) for 2 h at 4°C on an end-over-end rotator ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.4 0.15 M NaCl 0.1% Tween 20) with 1:100 protease inhibitor (78442, Thermo Scientific). The lysates were denatured by boiling ...
-
bioRxiv - Cell Biology 2023Quote: ... Ltd.) and 1/100 (v/v) of 1 M HEPES buffer (15630–106, Thermo Fisher Scientific) was added to the collected cells ...
-
bioRxiv - Cell Biology 2023Quote: Whole cell lysates were prepared in M-PER buffer (1x Mammalian Protein Extraction Reagent (Thermo Scientific), 0.1% Halt Protease & Phosphatase inhibitor (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the complementary cDNA was synthesized with an M-MLV Reverse transcriptase (Thermo Fisher Scientific, Waltham, MA). The synthesized cDNA was used as a template for qRT-PCR reactions ...
-
bioRxiv - Cell Biology 2023Quote: ... A 10X biotinylation buffer was prepared by diluting 1 M Tris-HCl pH 7.5 (ThermoFisher 15567027) to 100 mM and 0.5 M EDTA pH 8 (ThermoFisher AM9261 ...
-
bioRxiv - Developmental Biology 2023Quote: ... directly into a PCR plate containing 15 µL 1 M ammonium bicarbonate (Acros Organics, Geel, Belgium) solution by centrifugation (4 min ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL M-MLV Reverse Transcriptase (RT) (200 U/μL, Invitrogen, 28025-013, Breda, the Netherlands) and supplemented with RNAse-free ultra-pure water (ddH2O) ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were incubated with DAPI (1 μ /ml in 0.1 M phosphate buffer, Invitrogen #D1306, USA) for 15 min dark ...
-
bioRxiv - Genetics 2023Quote: ... blood was transferred to cryovials containing 0.5 M Perchloric acid acs reagent 70% (Thermo Fisher Scientific) and stored at -80°C until further processing ...
-
bioRxiv - Immunology 2022Quote: ... with program RNA_02 in M tubes (#130-096-335) in 1 ml of Trizol (Invitrogen, #15596018). The homogenates were centrifuged at 2000 g for 1 minutes at 4°C and the supernatant was collected ...
-
bioRxiv - Bioengineering 2023Quote: ... ACLY and/or ACSS2-KO cell lines were lysed in M-PER buffer (Thermo Scientific, 78501) with 1x protease inhibitor (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then washed in TNT buffer comprised of dH2O containing 0.15 M NaCl (Fisher Scientific), 0.1 M Tris HCl (pH 7.5 ...
-
bioRxiv - Microbiology 2023Quote: HEK-293Ts transfected with the indicated plasmids were lysed in M-PER lysis buffer (Thermo Scientific) supplemented with EDTA-free protease inhibitor (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... Whole cell lysates were prepared in M-PER buffer (1x Mammalian Protein Extraction Reagent (Thermo Scientific), 0.1% Halt Protease & Phosphatase inhibitor (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized from 1 μg of total RNA using the M-MLV (Invitrogen; 28025013). SYBR green master mix (Roche ...
-
bioRxiv - Physiology 2023Quote: ... The slides were then incubated in acidified water made of 0.05 M hydrochloric acid (Fisher Scientific) for 90 seconds ...
-
bioRxiv - Physiology 2023Quote: ... Isolated RNA was reverse-transcribed into cDNA using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) as described previously (19) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MOC1 and MOC2 cell lines were grown in DMEM supplemented with 10% M-FBS (Gibco, Mexico). All cell lines were profiled using short tandem repeats (STR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Whole cell lysates were prepared in M-PER buffer (1x Mammalian Protein Extraction Reagent (Thermo Scientific), 0.1% Halt Protease & Phosphatase inhibitor (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... N2A or NIH3T3 cells were plated 2000 cells/m and cultured in DMEM high glucose (GIBCO) containing 10% fetal calf serum ...
-
bioRxiv - Immunology 2023Quote: ... 200ng of RNA was used to synthesize cDNA with the M-MLV Reverse Transcriptase kit (Invitrogen). Il23a transcript expression was quantified using Il23a (FAM labelled ...
-
bioRxiv - Genomics 2024Quote: ... Cells were grown in culture in M-199 (ThermoFisher Scientific, Waltham, MA, MT-10-060-CV) supplemented with 1.2% sodium pyruvate (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... the glycopeptides were eluted twice using 200 µL of 0.8 M galactose (Thermo Fisher Scientific, A12813.18) prepared in 20 mM Tris by rotation at 4 ºC for 30 minutes each time ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant proteins were purified under denaturing conditions (8 M urea) using Ni-NTA resin (Thermo Scientific). The purity of the recombinant proteins was assessed via SDS-PAGE ...
-
bioRxiv - Microbiology 2024Quote: ... This solution was mixed with 0.4 mL of Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen) previously conjugated with 25 ug of S9.6 antibody (Millipore ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Microbiology 2024Quote: ... Nuclei were stained for 5 minutes in 5 μg/ml Hoechst 33258 dye (Thermofisher), and washed twice more in 1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...