Labshake search
Citations for Thermo Fisher :
2601 - 2650 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were mounted on ProLong Gold with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA, USA) and imaged using a Delta-Vision II microscope system with an Olympus IX-71 inverted microscope using a 100x objective A ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 x 105 – 4 x 105 mESCs were cultured in 60mm Petri dishes in DFNB medium (Neurobasal medium/Gibco, DMEM F12 1:1/Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Fluorescent indicators (fluo-4 AM, fura-2 AM, fura-FF AM) were purchased from Molecular Probes (Thermo Fisher Scientific). NMDA was from Merck Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... were resolved on precast NuPAGE 4-12% Bis-Tris midi 12+2-well protein gels (cat. no. WG1401BOX, Invitrogen) at 200 V for 40 min in NuPAGE 2-(N-morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Molecular Biology 2020Quote: ... Slides were mounted in ProLong™ Gold Antifade Mountant containing 4’,6’-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Images were acquired at 100x magnification using a Nikon Eclipse Ti fluorescence microscope fitted with a Hamamatsu C11440 digital camera ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole and were embedded with ProLong Gold mounting medium (Life Technologies). ImageJ/Fiji software (National Institutes of Health ...
-
bioRxiv - Neuroscience 2020Quote: Human sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) and coverslips were mounted using Prolong Gold (Invitrogen) for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were mounted in ProLong Gold antifade reagent supplemented with 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes). Conventional immunocytochemical staining was done to quantify the activated PAK1 and actin in oAβ and IPA-3 treated cells using phospho-PAK1 (Thr423)/PAK2 (Thr402 ...
-
bioRxiv - Systems Biology 2021Quote: ... Fat and lower dermis was cut away and discarded before dispase (2 U/ml, Gibco, UK, 20h, +4°C) digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... transfected with respective siRNAs (200 pmol/ well) on day 2 and day 4 using oligofectamine (Invitrogen; 10 μl/ well), and processed on day 6 for IFM or biochemical analyses ...
-
bioRxiv - Cell Biology 2021Quote: ... the insoluble pellet fractions (2 A260 units) were separated on NuPAGE 4-12% Bis-Tris 15-well gels (Invitrogen), run in NuPAGE 1x MOPS SDS running buffer (Novex) ...
-
bioRxiv - Systems Biology 2021Quote: ... Fat and lower dermis was cut away and discarded before dispase (2 U/ml, Gibco, UK, 20h, +4°C) digestion ...
-
bioRxiv - Genetics 2021Quote: ... overnight at 4°C and then for 2 hours with Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen 11201D). After 3 800uL washes in LiCl buffer (100mM Tris HCl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then washed twice with PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Scientific #D1306) diluted 1:200 in 0.5% BSA in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... loaded with 2-4 μM Fluo-5N and incubated with 200 nM MitoTracker® Red CMXRos – M7512 (Invitrogen, USA). To load Fluo-5N ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mesenteries were then stored for up to 48hrs at 4°C into PBS with 2% Antibiotic-Antimycotic solution (ThermoFisher).
-
bioRxiv - Bioengineering 2022Quote: ... glacial acetic acid) for 2 hours at room temperature (Section 2.14) or methanol-free 4% formaldehyde (ThermoFisher, Section 2.16) and then kept in PBS at 4°C before washing in gradations of ethanol up to 100% ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were mounted with the ProLong™ Diamond Antifade Mountant with 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher Scientific). Ki-67 signals were visualized with Nikon microscopy ...
-
bioRxiv - Neuroscience 2020Quote: ... Coverslips were affixed using Prolong Gold Antifade Mountant with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, Cat. # P36935).
-
bioRxiv - Microbiology 2020Quote: ... were quantified using an avidin and 4’-hydroxyazobenzene-2-carbocylic acid assay according to the manufacturer’s instructions (Fisher Scientific). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were washed again in PBS and incubated overnight with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and Alexa Fluor 647-conjugated βIII tubulin (Abcam ab190575) ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclear staining was performed by incubating slides with 4’,6-diamidino-2-phenylindole (DAPI, final 0.5 μg/mL; Invitrogen). Images were captured using an epifluorescence microscope (Nikon Eclipse Ni ...
-
bioRxiv - Cell Biology 2020Quote: ... Ni-NTA His.Bind® Resin (2-4 ml) was packed into a 10 ml Pierce disposable column (Thermo Fisher) and connected to the peristaltic pump ...
-
bioRxiv - Microbiology 2019Quote: ... Cell nuclei were stained with ProLong™ Diamond Antifade Mountant with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific). Samples were imaged using a confocal setup (Zeiss Airyscan equipped with a 63x ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were mounted on glass slides in 4′,6-diamidino-2-phenylindole (DAPI) containing Fluoromount-G medium (Thermo Fisher). Images were acquired by an Eclipse A1 laser-scanning microscope ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homogenised leaf tissues were centrifuged at 18,000 g 10 min 4 °C and 2 μL supernatant mixed with 48 μL Bradford reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 4 seconds at -2 force and vitrified in liquid ethane using a MarkIV Vitrobot (ThermoFisher). The blotting chamber was maintained at 22°C and 100% humidity during freezing.
-
bioRxiv - Microbiology 2019Quote: ... After 4 washes with PBS 0.01% v/v Tween-20 and 2 washes with ELISA Light washing buffer (ThermoFisher), CSPD substrate with Sapphire II enhancer (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... The slides were washed and mounted with ProLong Gold antifade reagent with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen) and images were acquired using Nikon A1-R confocal microscope using the NIS Elements software ...
-
bioRxiv - Molecular Biology 2019Quote: ... Coverslips were washed in 0.1% IGEPAL/PBS and mounted using ProLong Gold antifade reagent with 4’-6-Diamidino-2-phenylindole (DAPI) (Invitrogen). Immunofluorescence studies in HeLa cells were carried out as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... Mounting medium contained DAPI (4’, 6-diamidino-2-phenylindole) to visualize the nucleus (Molecular Probes Inc., Eugene, OR, USA). Negative controls were performed with either no primary or no secondary antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... The immunoprecipitates were dissolved in 2×SDS loading buffer and resolved on NuPAGE 4–12% Bis-Tris gel (Invitrogen), and then silver stained using Pierce silver stain kit (Thermo) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were immersed in 2ml dissociation solution (2% FCS-PBS solution with approximate 145U/ml type 4 Gibco collagenase) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with 0.2 μM of 4’,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Life Technologies, Carlsbad, CA) in PBS pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with 0.2 μM of 4’,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Life Technologies, Carlsbad, CA) in PBS pH 7.4 ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of capture Ab (~4 μg/ml) or SARS-CoV-2 recombinant antigen (~0.2 mg/ml) in 1x PBS (Gibco) was loaded in each channel ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2 hours at 250mA and 4°C using cold transfer buffer (1.5x NuPAGE transfer buffer (Thermo Fisher Scientific), 10% methanol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 2-well and 4-well chamber slides were transiently transfected with various cDNA constructs using Lipofectamine 2000 (Invitrogen) or FuGENE 6 (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Coverslips were mounted with Prolong gold antifade reagent with 4′,6-diamidino-2-phenylindole (DAPI, P36931, Thermo Fisher Scientific) and analyzed under a Zeiss LSM 510 Meta Confocal microscope (Carl Zeiss ...
-
bioRxiv - Microbiology 2022Quote: ... PCDH1 variants (sEC1-2 and sEC1-4) were generated by cloning the following sequences into the pcDNA3.1 mammalian expression vector (ThermoFisher): EC1-EC2 (residues 1-284 ...
-
bioRxiv - Neuroscience 2023Quote: ... and concentrated by centrifugation at 85,000x g for 2 hours at 4°C in a Sorvall WX 100 Ultra Ultracentrifuge (ThermoFisher). The supernatant was discarded and viral pellet resuspended in a volume of PBS containing calcium and magnesium (#14090-055 ...
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidine-2-phenylindole dihydrochloride And coverslipped using ProLong™ Gold Antifade Mountant (Invitrogen by Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidine-2-phenylindole dihydrochloride And coverslipped using ProLong™ Gold Antifade Mountant (Invitrogen by Thermo Fisher Scientific).
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... All cell lines were passaged regularly (every 2 to 4 days) with Accutase (PAA) or TrypLE (Thermo Fisher Scientific), and ESCs and EpiSCs were occasionally selected for Oct4 expression with 1µg/ml puromycin (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL RNase A/T1 Mix (4 µg RNase A, 10 U RNase T1, ThermoFisher Scientific, MA, USA) at 37°C for 30 min to remove host-originating nucleic acids ...
-
bioRxiv - Cell Biology 2024Quote: ... Gels were functionalized with 0.1M sulfo-succinimidyl 6-(4’-azido-2’-nitrophenylamino) hexanoate (Sulfo-SANPAH) (Cat# 22589, Thermo Scientific) dissolved in HEPES before overnight incubation in collagen type-I solution (Catalogue # A1048301 ...
-
bioRxiv - Cell Biology 2024Quote: ... Slides were washed in PBS and nuclei were stained with 4’-6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and mounted with an aqueous mounting medium (Aqua-Poly/Mount ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...