Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and fresh media was added and incubated for a further 24 hours before performing the viability assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific). The media was replaced with fresh cell culture media containing MTT (0.25 mg/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... cell vials were thawed 2-3 min in a 37°C water bath and transferred in T25 cell culture flasks (Gibco) with 5ml of hASC culture medium containing Minimum Essential Mediun (αMEM ...
-
bioRxiv - Neuroscience 2022Quote: ... NIM was exchanged daily for 3:1-DMEM/F12-medium (3 parts DMEM (Thermo Fisher Scientific, #31966047) and one-part F12 medium (Ham’s F-12 Nutrient Mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... the input aliquot (100 µl) was mixed with equal volume of 2× protein sample buffer (2× NuPAGE LDS buffer [Life Technologies], 100 mM DTT, 4% [w/v] SDS) and the IP with 100μl 1 x protein sample buffer followed by incubation for 10 min at 75 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... After 24 h illumination cells were resuspended and re-plated onto f/2-NH4 agar plates containing 80 μg mL−1 zeocin (Invitrogen). The plates were maintained under illumination for 3 weeks and the resistant colonies were screened by PCR for the presence of SYN genes as previously described (Falciatore et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... and AlexaFluor 555-conjugated F(ab’)2 fragment goat anti-rabbit (1:500; A21428, Invitrogen, Thermo Fisher Scientific, Waltham, MA). After five 5-minute washes with PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... AlexaFluor 647-conjugated F(ab’)2 fragment donkey anti-mouse (1:500; A31571, Life Technologies, Thermo Fisher Scientific, Waltham, MA), and AlexaFluor 555-conjugated F(ab’)2 fragment goat anti-rabbit (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... and AlexaFluor 555-conjugated F(ab’)2 fragment goat anti-rabbit (1:500; A21428, Invitrogen, Thermo Fisher Scientific, Waltham, MA). After five 5-minute washes with PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... AlexaFluor 647-conjugated F(ab’)2 fragment donkey anti-mouse (1:500; A31571, Life Technologies, Thermo Fisher Scientific, Waltham, MA), and AlexaFluor 555-conjugated F(ab’)2 fragment goat anti-rabbit (1:500 ...
-
bioRxiv - Biophysics 2020Quote: ... incubated 1 hour with Alexa Fluor 647-conjugated cross-adsorbed goat anti-mouse IgG F(ab’)2 (A-21237, Invitrogen) diluted at 1:1000 in 3% BSA/PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were incubated for 1 min with F(ab’)2-Goat anti-Rabbit IgG (H+L) Secondary Antibody QDot emitting at 655 nm (1 nM; Invitrogen) in PBS (1 M ...
-
bioRxiv - Microbiology 2023Quote: ... bacteria were incubated with 1:1000 diluted PE-conjugated F(ab’)2-anti-human-kappa-light-chain (Invitrogen, PA1-74408) in PBS/ 0.1% BSA (20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Bioengineering 2019Quote: ... TOPRO-3 (1:1000, in PBS) (Invitrogen, USA) was used for 15 min at room temperature to stain the nuclei.
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... 1× 10−3 М glutamine (Gibco, Cat:25030149) and 2 mg/ml gentamicin (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... in 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TO-PRO-3 (Thermo Fisher T3605, 1:10,000) to label dead cells ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA dye TOPRO-3 (1:1000, Invitrogen), diluted in a blocking buffer for 2 h at 24 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pan-cytokeratin (ThermoFisher, 3-9003-82, 1/50), pSmad1/5/8 (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... then washed 3 times with 1×PBS (Invitrogen). Roots were then squashed under coverslips onto slides that had been pre-treated with 3-Aminopropylthiethoxysilane (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) donkey anti-rabbit 488 (1:250, Invitrogen). To visualize immunofluorescence ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-V5 (Invitrogen, #R96025, 1:800, 3 days), anti-cFOS (Abcam ...
-
bioRxiv - Plant Biology 2022Quote: 5’-biotinylated RNA and unmodified RNA of Motif 3 (5’-AAAUCGCCGGAG-3’ 5’-Bio-AAAUCGCCGGAG-3’) were synthesized by Eurofins (Hamburg, Germany) and used for LightShift™ Chemiluminescent RNA EMSA Kit (Thermo Scientific). Total protein was extracted from LL and 10 min LL➔HL-treated plants using extraction buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... the hypervariable V3 region of the 16S rDNA gene was amplified from 20 ng of DNA using the primers 5′-CCTACGGGAGGCAGCAG-3′ and 5′-ATTACCGCGGCTGCTGG-3′ (Integrated DNA Technologies BVBA, Leuven, Belgium),(18) 1U Platinum® PCR SuperMix High Fidelity (ThermoFisher Scientific) and 10 μM of primer-mix ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated in 0.05 M Tris-HCl buffer (pH 7.6) containing 5 mg 3-3′ diaminobenzidine (Thermo Scientific, TA-060-HDX) per 10 mL buffer and a final concentration of 0.01% hydrogen peroxide for 15 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... and hybridized first using RT primer (5′/5Biosg/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′) and then reverse transcribed into cDNA using TSO primer (5′-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) and RT maxima reverse transcription (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (5′-AAGCAGTGGTATCAACGCAGAGT-3′ ...
-
bioRxiv - Microbiology 2024Quote: ... and a pan VSG reverse primer which binds to a conserved 14bp region of the 3’ UTR (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) with AmpliTaq Gold (Applied Biosystems, 4398881) (anneal & extension 60C 1m ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA was harvested from a 10 ml parasite culture (5% hematocrit; >3% parasitaemia) by resuspending the pelleted RBCs in 3 ml pre-warmed Trizol (Invitrogen #15596-018). After a 5 min incubation step at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... VOs we’re fixed for 1 hour in 4% paraformaldehyde solution (Thermo Fisher Scientific, 7732-18-5) in PBS and for 2 hours in 2.5% glutaraldehyde in PHEM buffer (TAAB ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL (10μM) reverse primer (ldh4_R, 5’-AATCACAGCAGCCCCTTG-3’) and 1 μL (1 U/μL) Platinum Taq DNA polymerase (Invitrogen, 10966-018) in a 50 μL total reaction volume ...
-
bioRxiv - Microbiology 2024Quote: ... Tenfold dilutions were used to infect confluent Vero E6 cells in a 96-well plate in MEM (5% FBS, 1% penicillin-streptomycin, 1% kanamycin, 3% amphotericin B (Gibco)) at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Genetics 2019Quote: ... 5’-6FAM-CTC AGA CCA GCT GAA G-MGB-3’ (Life Technologies). DENV-1 KDH0026A ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 3-5 days using Trypsin-EDTA (Gibco, 25200056). All experiments were done with cells at 10 passages or earlier with regular testing for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-ATTTGTCGACTCATTCTAATCCTTCGTCTTTTGATT-3′ by using Phusion high-fidelity DNA polymerase (Thermo Scientific) and cDNA prepared from the parasites as template ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... LUVs were prepared using sonication (Fisher Scientific, Ultrasonic Bath, 3 × 5 min). Sonication was performed in ice water bath ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each sample and incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... TOGARAM1 was depleted using siRNA with sequence 5′-CCUCGUAAUUCCUUAGAAA-3′ (Thermo Scientific) Cells were seeded onto coverslips at 70% confluency and transfected with 50 nM of siRNA in two sequential transfections using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... ID: s2513 (Silencer Select Validated; 5’-GA UAUACCCUGGAAAGUCUtt-3’) (Thermo Fisher Scientific) with JetPrime (Polyplus ...
-
bioRxiv - Microbiology 2021Quote: 8 x 103 HeLa-ACE2 cells and 3.2 x 104 HeLa or HeLa-sgLRRC15 cells (1:4 ratio) were co-plated per well in 8-well chamber slides (Nunc). The following day ...
-
bioRxiv - Biochemistry 2023Quote: ... 200 mM Tris-HCl, pH 8.0, 8 M Urea, 4% CHAPS, 1 M NaCl, supplemented with protease and phosphatase inhibitors, Thermo Scientific) was added to the pellets and the extracts were sonicated 10 x 3s with a probe sonicator ...