Labshake search
Citations for Thermo Fisher :
2601 - 2650 of 10000+ citations for 6 Methoxyquinoline 3 carboxaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 3 kDa Texas-red Dextran (Thermo Fisher, 500 μM) was injected into the periotic space of embryos at 48 hpf ...
-
bioRxiv - Physiology 2024Quote: ... and RT- qPCR performed by QuantStudio 3 (Applied Biosystems) with SYBR Green PCR Master Mix (Applied Biosystems 4309155) ...
-
bioRxiv - Cell Biology 2024Quote: ... The caspase 3/7 substrate activity assay (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... To stain nuclei we used To-Pro 3 (Invitrogen), 1:1000.
-
bioRxiv - Physiology 2024Quote: ... and for 3 min with DAPI (Invitrogen, Carlsbad, USA). Slides were mounted with a drop of mounting medium (Fluoroshield ...
-
bioRxiv - Neuroscience 2024Quote: ... Blasticidin (3 μg/ml, Thermo Fisher Scientific, MA, USA) and Zeocin (125 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probe was biotin labeled at the 3’ end using a Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific Inc.). Seven micrograms of nuclear protein were added to a binding reaction mixture containing 2µl 10X binding buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... via covalent attachment to COOH groups on the particles via standard EDC chemistry using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Thermo Fisher Scientific, MA) and N-hydroxysulfosuccinimide sodium salt (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were run on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher), and data were analyzed using the comparative CT method to generate expression fold-change values ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) and cells were mounted using Prolong Gold Antifade reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transiently transfected in 6-well plates with Lipofectamine 2000 (Life Technologies), as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Before mounting cells were stained with DAPI (4’,6-diamidino-2-phenylindole) dye (ThermoFisher) and mounted with Dako mounting medium and imaged by confocal microscopy and previously described 19.
-
bioRxiv - Cell Biology 2020Quote: ... 6-ketocholestanol or phloretin cells were incubated with di-8-ANEPPS (Thermo Fisher, D3167) at a final concentration of 2 μM on ice for 20 minutes (33 ...
-
bioRxiv - Cell Biology 2020Quote: ... differentiation was initiated on day -6 by adding RPMI/B27 minus insulin (Gibco, USA) supplemented with 1 μM CHIR 98014 (Selleckchem ...
-
bioRxiv - Microbiology 2021Quote: ... loaded on to a Novex Pre-cast 6% TBE-Urea (8M) polyacrylamide gel (Thermofisher) in 1X TBE and run for 45-60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was suspended in urea Dye and resolved on 6% TBU gel (ThermoFisher Scientific) at 200 V for 5 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... and subsequently incubated in 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) nuclear stain (Invitrogen). Slides were then washed in PBS and mounted using Prolong Gold Mounting Medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatant was collected and diluted 1:6 for BCA protein quantification (ThermoFisher #23227) and performed according to manufacturer’s guidelines ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Developmental Biology 2020Quote: ... Lower jaw timelapse experiments were carried out on 6-well transwell membranes (Nunc, 140642) with 2 ml of DMEM ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-6 ELISA assay was performed on collected media (Affymetrix eBioscience, #88-7066-22).
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using QuantiStudio 6 (Life Tech) with SYBR Power Green (Applied Biosystems). All the primer sequences used in this study can be found in Table S1.
-
bioRxiv - Molecular Biology 2021Quote: ... re-suspended in 6 μl water and quantified using Quant-IT RiboGreen (ThermoFisher, R11490). 1 μg RNA was resolved per lane on 1.2% glyoxal agarose gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 or 24-well dishes were transfected with siRNA using Lipofectamine RNAiMax (Life Technologies) following the manufacturers’ guidelines ...