Labshake search
Citations for Thermo Fisher :
2851 - 2900 of 10000+ citations for 6 Methoxyquinoline 3 carboxaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... Medium was changed 6 h after transfection with regular medium (11995-065; Gibco BRL).
-
bioRxiv - Cell Biology 2023Quote: ... The media was changed after 2 days to Essential 6 (Invitrogen Cat. No. A1516401) supplemented with b-FGF 20ng/mL (Peprotech US ...
-
A Drug-Free Pathogen Capture and Neutralizing Nasal Spray to Prevent Emerging Respiratory InfectionsbioRxiv - Bioengineering 2023Quote: ... C57BL/6 mice were administered with 10 µL per nostril of free DiR (Thermofisher) or PCANS mixed with DiR at a final concentration of 10 µg/ml) ...
-
bioRxiv - Immunology 2023Quote: ... Amplifications were performed with a QuantStudio 6 Pro Real-Time PCR System (Applied Biosystems). The assay lower LOD was 50 copies per reaction.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragment data were analyzed and visualized using the GeneMapper software version 6 (Applied Biosystems), and processed further using Adobe Illustrator ...
-
bioRxiv - Pathology 2023Quote: ... Tissue sections were embedded in cool 6% low-melting point agarose (ThermoFisher, Waltham, MA) in DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stained with DAPI (4′,6-diamidino-2-phenylindole; D1306, Thermo Fisher Scientific) prior to mounting (10-15 min at RT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA nicks were sealed by addition of 6 µL T4 ligase buffer (Thermo Fisher) and 2 µL T4 ligase (10 U ...
-
bioRxiv - Microbiology 2023Quote: ... Coverslips were mounted using SlowFade Gold with 4′,6′-diamidino-2-phenylindole (DAPI) (Invitrogen). Samples were analysed with an inverted Olympus IX81 widefield microscope ...
-
bioRxiv - Bioengineering 2023Quote: ... in tissue culture 6-well plates coated with reduced growth factor Geltrex (Gibco, A1413202) diluted in cold DMEM/F12 (dilution ...
-
bioRxiv - Genomics 2023Quote: RNA from cells grown in 6 well plates was extracted using TRIZOL (Invitrogen 15596026) and reverse transcribed using Superscirpt II Reverse Transcriptase (Invitrogen 18064022 ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher), 20 μg ml-1 AlexaFluor 488-labeled peanut (Arachis hypogaea ...
-
bioRxiv - Cancer Biology 2023Quote: ... CyQuant Direct reagent was added on day 6 according to the manufacturer’s protocol (ThermoFisher). Quantification was performed using a BioTek Synergy 2 plate reader.
-
bioRxiv - Systems Biology 2023Quote: ... Reactions were performed in a QuantStudio 6 Real-Time PCR System (Thermo Fisher Scientific), using SYBR Green chemistry (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Quantification was performed in triplicate using the QuantStudio 6 Pro qPCR machine (ThermoFisher Scientific). Rpl19 was used as the endogenous control for relative quantification.
-
bioRxiv - Immunology 2023Quote: Amplifications were performed with a QuantStudio 6 Pro Real-Time PCR System (Applied Biosystems). The assay lower LOD was 50 copies per reaction.
-
bioRxiv - Cancer Biology 2024Quote: ... 1.25*105 cells/well were seeded in 6-well plates (Thermo Scientific cat# 140675) and for mitochondrial enrichment ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from duplicate wells of 6-well plates using TRIzol (Invitrogen) according to the manufacturer’s instructions and quantified using a BioAnalyzer (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were counterstained in 300 nM DAPI (4’,6-diamidino-2-phenylindole; D1306, ThermoFisher), and/or 20 μg ml-1 AlexaFluor 488-labeled peanut (Arachis hypogaea ...
-
bioRxiv - Bioengineering 2024Quote: ... HEK293T cells were grown in a 6-well culture plate (ThermoFisher, cat. no. 140675) in DMEM with 10 % FBS (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were run on a QuantStudio 6 Flex 384-well qPCR apparatus (Applied Biosystems). Each target gene was normalized to HPRT ...
-
bioRxiv - Cancer Biology 2024Quote: ... MSCs were used up to passage 6 and harvested by incubating with TrypLE (Gibco) to gently detach the cells from the culture surface.
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA-infected cells cultured in 6-well plates were washed by DPBS (Gibco, #C14190500BT), followed by detachment using accutase (BioLegend ...
-
bioRxiv - Microbiology 2024Quote: ... as well as DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (1:1000; Invitrogen, #D1306) were diluted in DPBS with 1% FBS and incubated for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62248).
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was suspended in urea Dye and resolved on a 6% TBU gel (Invitrogen) at 200 V for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... Real-time PCR was performed in a QuantStudio 6 Flex PCR System (Applied Biosystems) using the Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... on a QuantStudio™ 6 Flex Real-Time PCR System (Thermo Fisher Scientific, 4485689). A table with qPCR primer design is included (Supplementary Table 7).
-
bioRxiv - Neuroscience 2024Quote: HeLa cells were plated in DMEM (Cellgro, #10-013CV) with 6% FBS (Gibco, #26140) at 10,000 cells per well in 96-well tissue culture-treated plates ...
-
bioRxiv - Microbiology 2024Quote: ... the proteins were first treated with 6× Laemmli SDS sample reducing dye (Thermo scientific) and boiled for 5 min at 100 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... The slides were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) and mounted ...
-
bioRxiv - Cell Biology 2024Quote: ... IMR90 PD 34 to PD 40 were seeded on 6 well plates (ThermoFisher, 140675) as the beginning points for the assays ...
-
bioRxiv - Cancer Biology 2024Quote: ... All qPCR was run on QuantStudio 6 flex real-time PCR system (Applied Biosystems). Relative abundance was calculated with delta-delta-Ct method ...
-
bioRxiv - Cell Biology 2024Quote: ... C2C12 cells on 6-well plates were transiently transfected with RNAiMAX (Invitrogen, 13778-150) according to the manufacturer’s directions in two stages to prevent over-confluency at the time of cellular treatment and lysis ...
-
bioRxiv - Developmental Biology 2020Quote: ... The target oligonucleotide was 3’ end labeled with biotin using a Biotin 3’ End DNA labeling kit (Thermo Fisher Scientific, Waltham, MA, USA, #89818). The oligonucleotides used as probes or competitors in gel shift assays were end-labeled at their 3’ ends with biotin ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...