Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations for Inhibin beta C chain INHBC Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Rubrum CbbM coding region in a His-bdSUMO plasmid acquired from Addgene65 using OneShotTM Top10 cells (Invitrogen). The constructs were expressed in OneShotTMBL21-AITM (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... with Radiant Probe Hi-ROX qPCR Kit (Alkali Scientific) and Taqman Gene Expression Assays (Thermo Fisher Scientific). The expression of target genes was normalized to Gapdh expression.
-
bioRxiv - Microbiology 2024Quote: His-tagged recombinant SdeC and its derivatives were bound to Ni-NTA (Thermo Fisher Scientific, Cat# 88221) resin at 1 μg enzyme per 25μl of packed resin in 1X ART buffer (20mM Tris 10mM NaCl ...
-
bioRxiv - Microbiology 2024Quote: His-tagged recombinant full-length SdeC derivatives were adsorbed to Ni-NTA (Thermo Fisher Scientific, Cat# 88221) resin at 1μg enzyme per 25 μl of packed resin in 1X ART buffer for 1 hr at 4°C with end-over-end rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... cyt-c-p (1:100, incubated overnight at 4°C, Thermo Fisher Scientific). All biological replicates were tested by western blotting.
-
bioRxiv - Physiology 2022Quote: ... C-IV-II and C-V-alpha (ThermoFisher Scientific, 45-8199; 1:2500). Secondary antibodies used were horseradish peroxidase–conjugated anti-mouse (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2024Quote: ... 60°C for 30 s and 72°C for 30 s (Applied Biosystems). 2−ΔΔCt method algorithm was used to analyze the relative changes in expressions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tubulin beta chain protein was detected with an anti-TUBB antibody (1:500 in 5% fat-free milk solution in TBST, Invitrogen MA5-16308) followed by an anti-mouse secondary antibody (Alexa Fluor™ Plus 800 ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA was further used for Real-time quantitative polymerase chain reaction (qPCR) performed on QuantStudio 7 Flex system (Invitrogen™ Life Technologies) using Fast SYBR Green Master Mix (Life Technologies).
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was measured by quantitative real real-time polymerase chain reaction (qRT-PCR) using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) with primers and probe specific for the CCHFV L gene.
-
bioRxiv - Evolutionary Biology 2020Quote: Amplification of DNA fragments via polymerase chain reaction (PCR) was done using the Phusion High Fidelity DNA_Polymerase (Thermo Fisher Scientific, Waltham, USA). The PCR reactions were set up in a 20 μl reaction volume using DNA templates indicated in the respective experiments and buffer recommended by the manufacturer containing a final concentration of 3% DMSO ...
-
bioRxiv - Bioengineering 2019Quote: ... 250 ng of cDNA was added to each quantitative polymerase chain reaction (qPCR) along with the Taqman™ master mix (Thermo Fisher) and pre-designed Taqman human-specific primer/probe sets per manufacturer’s protocols ...
-
bioRxiv - Biophysics 2021Quote: ... The recombinant constructs of heavy and light chain were transfected at 1:1 ratio into Expi293F™ cells using the ExpiFectamine™ 293 Transfection Kit (Gibco™ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we extracted DNA from many individuals from each collection using a standard squish buffer protocol and identified Wolbachia infections using polymerase chain reaction (PCR) (Simpliamp ThermoCycler; Applied Biosystems, Singapore) (Meany et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant antibodies were expressed in Expi293 cells following co-transfection of heavy and light chain plasmids (1:1 ratio) using Expifectamine 293 (Thermo Fisher Scientific). Supernatants were harvested after 5-6 days ...
-
bioRxiv - Microbiology 2021Quote: ... Appropriate correction factors for the individual TMT channels for both lysine side-chain labelling and peptide N-terminal labelling as per the TMT-6plex kits used (Thermo Fisher Scientific) were configured into the database search ...
-
bioRxiv - Plant Biology 2021Quote: Initial validation of the flg22 treatment was assessed with real-time (RT) quantitative polymerase chain reactions (qPCR) on a QuantStudio 6 instrument (Thermo Fisher Scientific), using the total RNA extracted for the CAGE library preparations and the ΔΔCt method ...
-
bioRxiv - Microbiology 2020Quote: ... and quantitative real-time polymerase chain reaction (qRT-PCR) was conducted using TaqMan Fast Virus 1-Step Master Mix (Thermofisher Scientific, US) with primers and probe specific for the SARS-CoV-2 E gene following guidelines by the World Health Organization (https://www.who.int/docs/default-source/coronaviruse/wuhan-virus-assayv1991527e5122341d99287a1b17c111902.pdf ...
-
bioRxiv - Genomics 2022Quote: ... To evaluate the effect of SOCS2 editing on inflammatory gene response quantitative polymerase chain reaction (qPCR) was performed on a QuantStudio™ 6 Flex machine (Applied Biosystems) with TaqMan™ Universal Master Mix and TaqMan Gene Expression Assays for human CCL2 (Hs00234140_m1) ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). From 2μg total RNA ...
-
bioRxiv - Immunology 2020Quote: Cloned mAb vectors for IgG1 heavy chain and Kappa or Lambda light chains were co-transfected at a ratio of 1:3 (H:K/L) into Expi293F cells (Thermo Fisher Scientific Inc.) using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Immunology 2020Quote: ... and sample C RNA was reverse transcribed using a TCRB chain constant region reverse primer with Superscript III First-Strand Synthesis System (Invitrogen, Waltham, MA). cDNA was column purified with the Oligo Clean and Concentrator Kit (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... with equal amount of paired heavy and κ-light chain plasmids and purified from the culture supernatant after 12-14 days using Protein A beads columns (Thermo Fisher).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantitative polymerase chain reactions (qPCRs) were performed in 384-well plates in a 7900HT fast real-time PCR (Thermo Fisher, Madrid, Spain) using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... were transfected with plasmids carrying J08 and 02M04 antibody heavy and the light chains with a 1:2 ratio using ExpiFectamineTM293 Transfection Kit (Thermo Fisher Scientific) as recommended by the manufacturer ...
-
bioRxiv - Genomics 2022Quote: DNA from homozygous mutant flies was sequenced by the Sanger chain termination method using a BigDye Terminator Kit v3.1 (ThermoFisher Scientific, Waltham, MA), with the same primers used to identify deletions ...
-
bioRxiv - Pathology 2021Quote: ... or an HRP-conjugated goat anti-monkey IgG heavy and light chain antibody (A140-102P, 1/10000, 50 µL/well, Thermo Fisher Scientific) in 5% skim milk in PBS-T for 1 h at 37℃ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Real-time polymerase chain reaction (PCR) was performed using an Applied Biosystems™ Fast SYBR™ Green Master Mix (Thermo Fisher Scientific). Primer sequences used for real-time PCR are Nluc-1F:CAGGGAGGTGTGTCCAGTTT ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the diluted cDNA with either TaqMan Gene Expression Master Mix (Applied Biosystems, 4369016) or PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... with equal amount of heavy and κ-light chain plasmids and purified from culture supernatants after 12-14 days using Protein A beads columns (Thermo Fisher).
-
bioRxiv - Immunology 2020Quote: ... The purified plasmid DNA (both heavy and light chain) was transfected into a 30mL culture of HEK Expi293 cells (Thermo Scientific Expi293). Harvesting the culture after 5 days ...
-
bioRxiv - Microbiology 2020Quote: ... recombination cassettes were generated from the pEPKanS template by polymerase chain reaction (PCR) with Phusion High Fidelity DNA polymerase (Thermo Fisher Scientific) using long oligonucleotides (Ultramers ...
-
bioRxiv - Immunology 2020Quote: ... plasmids with antibody heavy and light chain genes were used to transfect suspension Expi 293i cells using ExpiFectamine 293 transfection reagents (Thermo Fisher Scientific) as described (20) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and YrbA open reading frames (ORFs) were generated by polymerase chain reaction (PCR) and AccuPrime Taq DNA Polymerase (Thermo Fisher Scientific, USA). The sequences of the primers used for PCR are shown in Table S1 ...
-
bioRxiv - Genetics 2022Quote: ... The SARS-CoV-2 infection was screened and confirmed by at least one quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) assay with the Applied Biosystems 7500 Fast RT-PCR System (Thermo Fisher Scientific), using a protocol previously described for the detection of 2019 novel Coronavirus (2019-nCoV ...
-
bioRxiv - Physiology 2022Quote: Relative gene expression in undifferentiated cells and 21 day ALI differentiated monolayers was assessed using quantitative reverse transcription–polymerase chain reaction (qRT-PCR) with the SuperScript III Platinum SYBRGreen OneStep qPCR Kit (Life Technologies, UK) and an AriaMX real-time thermal cycler ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative real-time polymerase chain reaction (qPCR) was performed using a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was amplified using the Power SYBR Green PCR Master Mix (catalog #4367659 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression was assessed with real-time quantitative polymerase chain reaction (qPCR) using SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, MA) on a Roche LightCycler 480 II (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis was performed by using the ViiA7 or QuantStudio Real-time PCR system (Thermo Fisher Scientific) using TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time quantitative polymerase chain reaction (RT-qPCR) was performed with AmpliTaq Gold polymerase in an Applied Biosystems 7500 thermocycler (Thermo Fisher Scientific). Primer sequences are available upon request.
-
bioRxiv - Microbiology 2024Quote: ... Conventional two step reverse transcriptase polymerase chain reaction (RT-PCR) was employed using the Invitrogen SuperScript IV first-strand synthesis system (Thermo Scientific, USA) for cDNA synthesis and DreamTaq Green PCR Master Mix (2X ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quantitative polymerase chain reaction (qPCR) analysis was performed using a QuantStudio 12 K Flex real-time PCR system (Applied Biosystems, United States) and Luminaris color probe qPCR master mixes (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: Cloning and mutagenesis in this work were carried by Polymerase Chain Reaction (PCR) with Phusion Hot Start II DNA Polymerase (Thermo Fisher Scientific). For initial protein characterization ...
-
bioRxiv - Immunology 2023Quote: ... comprising the variable heavy chain and light chains joined with the 15-residue linker was transiently expressed in a secreted form using FreeStyle™ 293-F cells (Thermo Fisher) in FreeStyle™ F17 Expression Medium supplemented with L-glutamine and 1x MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... The 25 μL of polymerase chain reaction of each reaction included 12.5 μL of Master Mix AmpliTaq Gold™ 360 (Applied Biosystems, USA), 20 mM of each primer and 6 μL od DNAse/RNAse free water ...
-
bioRxiv - Microbiology 2023Quote: ... the recombination cassette was generated from the pEPKanS template by polymerase chain reaction (PCR) with Phusion High Fidelity DNA polymerase (Thermo Fisher Scientific) using long oligonucleotides (Ultramers ...
-
bioRxiv - Microbiology 2023Quote: ... to be separated on 8% SDS-polyacrylamide gel electrophoresis (PAGE) or subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) using Superscript IV (Invitrogen Life Technologies), to create cDNA and then DNA to amplify for sequencing.
-
bioRxiv - Microbiology 2023Quote: ... real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR) with the 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA) using Taqman probe (Mm00458221 ...
-
bioRxiv - Molecular Biology 2023Quote: The expression plasmids encoding the heavy and light chains of 8ANC195 (expression plasmids kindly provided by Michel Nussenzweig, the Rockefeller University) were transiently transfected into Expi293F cells (Thermo Fisher Scientific) using ExpiFectamine 293 transfection as described (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Appropriate correction factors for the individual TMT channels for both lysine side-chain labelling and peptide N-terminal labelling as per the TMT-6plex kits used (Thermo Fisher Scientific) were configured into the database search ...