Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were stained with 300 nM 4’,6-diamidino-2-phenylindole nucleic acid stain (DAPI; Invitrogen) in PBS for 5 min followed by washing three times in PBS at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Neuroscience 2022Quote: ... NPC cultures received 100 pM acetic acid vehicle or 100 ng/ml IL-6 (Gibco; PHC0066) on day 18 for 3h ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with primary antibodies (anti-ZO-1, 1:50, Life Technologies; anti-occludin, 1:50, Life Technologies; anti-claudin-5, 1:50, Life Technologies;) respectively at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated with secondary antibodies conjugated to HRP at 1:20,000 in 5% milk/1x TBST for 1 hour (goat anti-mouse-HRP, 32430; ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... human recombinant Epidermal Growth Factor 1-53 (EGF 1-53, 5 ng/ml, Thermo Fisher Scientific, catalog #17005-042) and 1% penicillin/streptomycin ...
-
bioRxiv - Bioengineering 2019Quote: ... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... at 37 °C with 5 % CO2 with 1 % penicillin/streptomycin (PS, 5000 U.mL-1 and 5000 μg.mL-1respectively; Life Technologies) and supplemented with 1% non-essential amino acids (Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... the stromal layer was washed with PBS and was subject to mild trypsinisation with 1:5 dilution of 0.25% Trypsin 1 mM EDTA (Thermofisher) to remove attached residual leukaemic cells before completely detaching stromal cells with 0.25% Trypsin-EDTA.
-
bioRxiv - Systems Biology 2021Quote: ... Dried lipid fractions (~5 mg) were dissolved (isopropanol/dichloromethane 1:1, 300 μL) for accurate mass LC-MS (ThermoFisher Q exactive with Dionex Ultimate 3000 sample handler and Waters acquity UPLC BEH C18 with 1·7 μm particle size LC column ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions contained 1 μl of 1:10 diluted lysate and 5 μl premixed AmpliTaq-Gold (0.3U, Life Technologies) with 0.26 μM of target-specific- and an additional fluorescent forward primer ...
-
bioRxiv - Biochemistry 2020Quote: SHSY5Y cells were obtained from the Duke University Cell Culture Facility and were maintained at 37 °C with 5% CO2 in DMEM:F12 (1:1; Gibco) supplemented with 10% FBS (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2019Quote: ... Rh (10 µg L-1) and Ir (5 µg L-1) in 2% trace analysis grade (Fisher Scientific, UK) HNO3 ...
-
bioRxiv - Physiology 2021Quote: ... Frozen tissues were mechanically homogenized with 1 stainless steel bead (5 mm) in 1 ml Trizol (Thermo Fisher Scientific) by shaking for 50 s at 30 Hz (TissueLyser ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were incubated for 1 hour in a solution containing 5% FBS and 1:500 primary antibody (H3K9me3; Invitrogen rabbit polyclonal 49-1008 or H3K9Ac ...
-
bioRxiv - Cell Biology 2020Quote: ... All cells were maintained in 1:1 Ham’s F12 Dulbecco’s modified Eagle’s medium (FDV) containing 5% fetal bovine serum (FBS) (Thermo Fisher Scientific) and 5ml/500ml 100X penicillin-streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated with secondary antibodies conjugated to HRP at 1:20,000 in 5% milk/1x TBST for 1 hour (goat anti-mouse-HRP, 32430; ThermoFisher Scientific and goat anti-rabbit-HRP ...
-
bioRxiv - Immunology 2021Quote: ... were diluted in two-fold dilution series from 1:5 to 1:5120 in Eagle’s Minimum Essential Medium (Gibco) with 5% FCS (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... primary antibody diluted in 5% NGS in PBS (β-catenin 1:200, ProteinTech, rhodamine-phalloidin 1:200, Molecular Probes) for 36 hours at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FBS and antibiotics (penicillin 100 U ml−1, streptomycin 100 U ml−1 (pen/strep) (Gibco), 10mM glutamax (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1×3–5 min with 1x PBS + 1 ng/mL DAPI and mounted in ProLong Gold antifade reagent (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... 5′-labelled Aar RNA (4 nM) was incubated for 1 h at 37°C with 1× structure buffer (Ambion), 1 µg yeast RNA and putative mRNA interaction partners at the indicated concentrations (0 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies were used at a ratio of 1:500 in 5% GS/1% BSA/0.2% PBST (anti-rabbit-Alexa-Fluor-555, Invitrogen A27039 ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 μL of samples and 5 μL of standards were diluted into 95 μL of 1× SYBR green (Invitrogen) in TE buffer and mixed by pipette ...
-
bioRxiv - Immunology 2020Quote: ... were stained with 0.25 ug of Mamu MR1 5-OP-RU or Ac-6-FP tetramer for one hour in the presence of 500 nM Dasatinib (Thermo Fisher Scientific; Cat No. NC0897653). When TCRVα7.2 co-staining was performed ...
-
bioRxiv - Cancer Biology 2020Quote: Gene-specific knockdown was achieved by reverse-transfection of PCa cell suspensions (total 5×105 cells) with 12.5 nM siRNA in 6 well plates using RNAiMAX transfection reagent (Life Technologies; Thermo Fisher Scientific, Scornsby, VIC, AUS), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Microbiology 2021Quote: ... were stained with 0.25 ug of Mamu MR1 5-OP-RU or Ac-6-FP tetramer for one hour in the presence of 500 nM Dasatinib (Thermo Fisher Scientific; Cat No. NC0897653). When TCRVα7.2 co-staining was performed ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free supernatants were diluted to 8 mg/mL and 5 µL of sample was combined with 5 µL of NovexTM Tris-Glycine SDS Sample Buffer (Invitrogen) to load 40 µg per well ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Microbiology 2022Quote: ... Health and Nutrition (Japan) and cultured at 37 °C with 5% CO2 in DMEM (WAKO) containing 5% fetal bovine serum (Gibco) and penicillin/streptomycin (100 U/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digests were allowed to stand for 5 min at room temperature and the supernatants were added to 5 ml of foetal bovine serum (FBS; Gibco) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Triton X-100 for 5 min and incubated with a blocking buffer containing PBS and 5% normal goat serum (31873; Invitrogen) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then centrifuged at 400 rcf for 5 minutes and resuspended in cold flow cytometry buffer (calcium free HBSS with 5% fetal bovine serum (FBS, Gibco), 2 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: ... mice were woken up to allow any fecal matter to evacuate and then anesthetized again to introduce 100μL of Cy-5-labelled glucose or Cy-5 secondary goat anti-rat antibody (0.1mM diluted in PBS, ThermoFisher A10525) into the colon via a gavage needle enema ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting cDNA was subjected to 5’ rapid amplification of cDNA ends (5’-RACE) with the use of a GeneRace Kit (Invitrogen) and with region-specific primers.
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... The coverslip with the sample was then inverted into the center of an imaging dish containing 150 μL of imaging buffer (Tyrode’s with 5% cosmic calf serum and 5 μg/mL Hoechst 34580 (Invitrogen #H21486), mixed by pipette and vortexed ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Fractions were loaded onto a cartridge precolumn (5 mm x ID 300 μm, C18 PepMap 100 A, 5 μm particles (ThermoFisher)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were injected onto a PepMap100 trap column (0.3 x 5 mm packed with 5 μm C18 resin; Thermo Scientific), and peptides were separated by reversed phase HPLC on a BEH C18 nanocapillary analytical column (75 μm i.d ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were trapped and desalted on a C18-column (5 μm Acclaim PepMap100 300 μm x 5 mm, ThermoFisher Scientific) at a flow rate of 30 μl/min with solution A (1% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2020Quote: ... cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS at 37°C and 5% CO2 along with penicillin and streptomycin antibiotics (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... One milliliter of the culture was incubated for 5 min (at 37°C) with the membrane dye Nile Red (5 µg/ml, Invitrogen), washed once with phosphate buffered saline (PBS) ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...