Labshake search
Citations for Thermo Fisher :
2451 - 2500 of 10000+ citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Biochemistry 2020Quote: ... UK) with an Acclaim PepMap C18 trap column (0.3 mm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific). The mobile phases were A ...
-
bioRxiv - Bioengineering 2019Quote: ... The montaged image in Figure 5 C ii and 5 C iii were generated by stitching together individual images using MAPS 1.1 software (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Cancer Biology 2023Quote: ... and LCPNS-SIIN-Cxcl1KO cells were cultured at 37°C under 5% CO2 / 5% O2 in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 medium, Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml leupeptin and 5 µg/ml E-64) and HALT phosphatase inhibitor (Thermo Fisher Scientific, Waltham, MA). Detergents were NP-40 or Brij 96V (both from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 400 nM each of forward and reverse primer (S2 File) ...
-
bioRxiv - Microbiology 2024Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Microbiology 2023Quote: ... host cells at 37°C and 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic Calf serum (HyClone) ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Microbiology 2023Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO] ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... Peptides were loaded onto a trap column (C18 PepMap100, 5 μm, 100 Å, 5 mm × 300 μm, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Microbiology 2022Quote: ... HCT-8 cells were cultured as above with additional 1X MEM Non-Essential Amino Acids (NEAA, ThermoFisher) supplemented ...
-
bioRxiv - Plant Biology 2022Quote: ... HPTS (8-Hydroxypyrene-1,3,6-Trisulfonic Acid, Trisodium Salt, 100 mM stock in water; Thermo Fisher Scientific, H348) were used ...
-
bioRxiv - Biophysics 2021Quote: ... buffer B (5 mM Tris-HCl pH 8.0, 10 mM MgCl2, 1 mM EDTA; Ambion), BSA-biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... Adherent cells were passaged at a 1:5 dilution using 0.05% trypsin EDTA (Gibco #25200056). PLB cells were a kind gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... N2B27 1-5% KSR base media was supplemented with 1x NEAA (ThermoFisher Scientific 11140-050); 10 ng/mL recombinant human LIF (hLIF ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in 1 mL solution containing 5 μL Vybrant DiO (Molecular Probes, V22886) or Vybrant DiD (Molecular Probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 min incubation (at 37 °C) of Hoechst dye (Life Technologies; 1:15,000 dilution) in warm PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anesthetized fish were injected intraperitoneally with 5 µl of 1 mg/mL EdU (Thermo Fisher) in sterile PBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissected embryos were incubated with 1 mL of 5 µM LysoTracker Red DND-99 (Invitrogen) in HBSS for 45 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... then permeabilized for 1 h with 0.3% Triton X-100 and 5% NGS (Gibco, PCN5000). Slices were then incubated overnight with or without 15F1 α GluA2 (1 µg/mL ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS+1 (10 µg/mL insulin, 5.5 µg/mL transferrin, 5 ng/mL selenium; Gibco), 100 µM ascorbic acid 2-phosphate (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged 1:5 at ∼80-90% confluency with 0.25% Trypsin (15090-046; Gibco). Co-culture assays were performed by incubating cells in 2.5 μM CFSE (65-0850-84 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged 1:5 at ~80-90% confluency with 0.25% Trypsin (15090-046; Gibco). Cells were routinely screened for mycoplasma ...
-
bioRxiv - Neuroscience 2020Quote: ... claudin-5 (1 μg/ml) and occludin (2 μg/ml; all from Thermo Fisher Scientific). After incubation with primary antibodies membrane was washed with PBS-T three times on a platform rocker and incubated with horseradish peroxidase-conjugated secondary antibody diluted in PBS-T 1:2000 (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 1:5 000 dilutions of anti-rabbit or anti-mouse HRP-conjugated antibodies (Thermo Scientific), and SuperSignal Femto West (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... After washing, blocking buffer (TBS, 5% NGS, 1%BSA, 0.1% Triton or BlockAid solution (Thermofisher)) was applied for 30 min ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... DRG neurons were loaded with 1 μg/μl Fura 2AM (108964-32-5; Life Technologies) for 1 hour before changing to normal bath solution (135 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... secondary antibody (anti-mouse AlexaFluor 488 or 546, ThermoFisher, dilution 1:500 in 5% BSA) was incubated on each microscope slide for 60 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5% non-heat inactivated serum (Gemini) and 1% Insulin-Transferrin-Selenium-Ethanolamine (ITS) (ThermoFisher). CWR22Rv1 (Rv1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... day 5 transient ADE clusters were dissociated 1 volume of trypsin-EDTA [0.25%] (Thermo Fisher) for 5 minutes at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... The diluted (1/5) total cDNA was subjected to Taqman gene expression analyses (ThermoFisher Scientific) using transcript-specific probes and primers (Supplementary Table 3) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 mM KCl and 1 mM MgSO4) in chambered Lab-Tek II coverglass (Thermo Scientific). Pollen grains from fully opened flowers were spread onto the medium layer ...
-
bioRxiv - Cell Biology 2019Quote: ... and resuspended in 5 ml StemFlex™ media with 1 × RevitaCell supplement (ThermoFisher Scientific, A2644501) for plating for the first 24 hrs.
-
bioRxiv - Synthetic Biology 2019Quote: ... at a final concentration of 5 μM in Gibco DMEM high glucose 1× (Life Technologies) with 10% Tet-free Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2019Quote: ... and cultured (37 °C, 5% CO2) on Petri dishes containing DMEM with 1% HEPES (Gibco), 10% FBS and 20% L cell-conditioned medium (LCM ...
-
bioRxiv - Biophysics 2019Quote: ... 5% CO2 atmosphere in Dulbecco’s modified Eagle’s medium with 1 g/mL glucose (Gibco 31885023) supplemented with 1% penicillin-streptomycin (Sigma P0781) ...