Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Gene expression was quantified with qRT-PCR based TaqMan Assays (ThermoFisher) using the following assays ...
-
bioRxiv - Neuroscience 2019Quote: ... and cultured in Neurobasal A/B27-based medium (Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Genomics 2020Quote: ... based on overlapping SNPs with the Axiom Human Origins array (Affymetrix), with HLA allelic resolution at the protein level (HLA - 2 fields) ...
-
bioRxiv - Immunology 2020Quote: ... Column-based Pierce™ protein G (Thermo Fisher Scientific, catalog #20397) purification of IgG was done according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... measurements were normalized based on cell seeding density using CyQuant (Invitrogen). For the mitostress test ...
-
bioRxiv - Molecular Biology 2024Quote: ... based on the SeeBlue2 plus molecular weight ladder (Thermo Fisher Scientific), were excised with a clean scalpel ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cloning reactions were based on the enzymes BbsI (Thermo Scientific, ER1011) or BsaI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... N2 differentiation medium was based on DMEM/F12 (10565042, Thermo Fisher) by supplementing with 1% N2 supplement (17502-048 ...
-
bioRxiv - Immunology 2023Quote: ... tissues were collected in 1mL phenol-based TRIZOL (Thermo Fisher Scientific) and homogenized in a TissueLyser II (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: Plasmids were mainly constructed based on the Gateway technology (Life technologies). Primers used in the plasmid construction are listed in Table S1 ...
-
bioRxiv - Genetics 2023Quote: ... cells were cryopreserved in DMSO-based Recovery Cell Cryopreservation Media (Gibco). After overnight cooling at -80°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... cellular RNA was prepared TRIzol-based RNA extractions (Thermo Fisher Scientific) according to manufacturer’s protocol and solubilize in H2O ...
-
bioRxiv - Neuroscience 2023Quote: ... Trizol based RNA isolation proceeded in accordance with manufacturer protocol (Invitrogen). cDNA synthesis was carried out using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... which was a customized DMEM-based media (ThermoFisher Scientific, cat # A4192101) containing 1% BSA (Millipore Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... by culturing in growth medium (GM) based on DMEM Glutamax (Gibco) supplemented with 20 % fetal calf serum (FCS ...
-
bioRxiv - Genetics 2024Quote: ... Ltd., (Wuhan, China) based on UHPLC-MS/MS analysis (Thermo Scientific Ultimate 3000 UHPLC coupled with TSQ Quantiva) ...
-
bioRxiv - Biochemistry 2021Quote: ... The 5 mL HisTrap column was washed with 10 column volumes of wash buffer (2× GIBCO 14200-075 PBS, 5 mM Imidazole, pH 7.5) followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the precolumn ...
-
bioRxiv - Biochemistry 2024Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the pre-column ...
-
bioRxiv - Immunology 2021Quote: ... ABC amplification and DAB detection (both ThermoFisher). Slides were then counterstained with Meyer’s haematoxylin and coverslips applied with aqueous mounting agent and slides imaged using Zeiss axioscan Z1 ...
-
bioRxiv - Immunology 2019Quote: ... were detected by enhanced chemiluminescence detections (Thermofisher) using a Biorad ChemiDoc MP ...
-
bioRxiv - Biochemistry 2021Quote: ... using detection chemistry (SYBR Green; Applied Biosystems), were run in triplicate on 96-well reaction plates.
-
bioRxiv - Cancer Biology 2020Quote: ... using SYBR Green detection tools (Applied Biosystems). Primers can be found in supporting methods ...
-
bioRxiv - Cancer Biology 2020Quote: ... and HT7900 sequence detection system (Applied Biosystems) per manufacture specifications ...
-
Listeria monocytogenes gene essentiality under laboratory conditions and during macrophage infectionbioRxiv - Microbiology 2022Quote: ... The ECL chemiluminescence detection system (Thermo Scientific) was used for detection of the peroxidase conjugates on the PVDF membrane in a chemiluminescence imager.
-
bioRxiv - Neuroscience 2021Quote: ... Sequence Detection Software (version 1.3; Applied Biosystems) results were exported for calculations.
-
bioRxiv - Microbiology 2021Quote: ... and a TMB substrate detection system (Invitrogen). A standard curve was generated using linear regression of OD450 of known recombinant mucoricin concentrations and the concentrations of toxin in the medium were extrapolated from the standard curve.
-
bioRxiv - Bioengineering 2020Quote: ... and biotinylated detection antibody pairs from Invitrogen™ ...
-
bioRxiv - Cancer Biology 2019Quote: ... for oxidative stress detection (Thermo Fisher, C10422).
-
bioRxiv - Bioengineering 2021Quote: ... for oxidative stress detection (#C10422, ThermoFisher Scientific) in media and incubated for 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green detection tools (Applied Biosystems). Expression of each gene was normalized to TATA Box Protein (Tbp ...
-
bioRxiv - Microbiology 2020Quote: ... The ECL chemiluminescence detection system (Thermo Scientific) was used for detection of the peroxidase conjugates on the PVDF membrane in a chemiluminescence imager (Vilber Lourmat) ...
-
bioRxiv - Cell Biology 2022Quote: ... using SYBR Green detection tools (Applied Biosystems). In skeletal muscle tissue ...
-
bioRxiv - Cancer Biology 2022Quote: ... An UltraVision ONE Detection System (Thermo Fisher) was used following the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... For detection PierceTM enhanced chemiluminescent substrate (ThermoFisher) in combination with the GE Healthcare Amersham machine was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by chemiluminescence detection (Thermo Fisher Scientific) using the ChemiDoc imaging system (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by detection by enhanced chemiluminescence (ThermoFisher).
-
bioRxiv - Molecular Biology 2023Quote: ... and chemiluminescent detection (ThermoFisher Scientific, Millipore WBKLS0500) were used to develop immunoblots ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA plates (MaxiSorp Nunc-immuno plates) were coated with 1 μg/ml of anti-CH3 (MCA878G ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA plates (MaxiSorp Nunc-Immuno plates) were coated with 1 μg/ml recombinant RBD-His protein antigen (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2019Quote: ... chilled on ice for 5 min and electrophoresed in a 3 – 8% Tris-Acetate NuPAGE gel (Novex Life Technologies). Transfer of the proteins onto a nitrocellulose membrane was done in transfer buffer (5% methanol ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were washed 3 times with WB and nuclei were stained for 5 min with Hoechst 33342 (Life Technologies) in WB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3% and 5% weight/volume (w/v) MeHA solutions were prepared in Dulbecco’s phosphate buffered saline (DPBS; ThermoFisher, 14190136) with 0.05% w/v Irgacure 2959 (I2959 ...
-
bioRxiv - Biochemistry 2020Quote: ... The staining solutions contained 5 μM CM-H2DCFDA or 3 μM MitoSOX™ (both Thermo Scientific, MA, Waltham, USA) diluted in HEPES/HSA for the detection of intracellular or mitochondrial ROS ...
-
bioRxiv - Neuroscience 2020Quote: ... the slices were rinsed 3 times in PBS and incubated in PBS with DAPI (5 μg/ml, Invitrogen, #D1306) and the following secondary antibodies at 4°C for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... a DNA fragment comprising the entire coding region of kpfR plus approximately 550 pb of 3’ and 5’ flanking regions (Table S4 in the supplemental material) was inserted on pCR2.1-TOPO vector (Invitrogen) previously cloned with erythromycin-resistance gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...