Labshake search
Citations for Thermo Fisher :
2451 - 2500 of 10000+ citations for Recombinant Human ITGAV & ITGB5 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and stained with Alexa Fluor 555-tagged donkey-α-goat secondary antibody (Molecular Probes, 1:1000) for 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... Hexa-histidine tagged mTHSD7A fragments were purified under native conditions using Ni-NTA resin (Thermo Scientific) applying the batch method according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Rab7a and LAMP1 wt and mutant molecules tagged with EGFP using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... WRN Halo-tagged HCT-116 cells were seeded in FluoroBrite DMEM (Thermo Fisher, cat. no. 1896701) supplemented with 10% FBS (Corning) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tissues from Knock-in LAP-tagged PAF1C flies were detected with anti-V5 tag (Invitrogen, R96025) 1:500 in BBX incubated overnight at 4°C with nutation ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells in 35-mm dishes were transfected with 100 pmol of each siRNA in the Stealth siRNA library targeting 154 human nuclear proteins (Invitrogen–Thermo Fisher Scientific) using Lipofectamine RNAiMax (Invitrogen–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: Cell culture supernatants were analyzed for secreted proteins using Immune Monitoring 65-Plex Human ProcartaPlex™ Panel for MAGPIX (Thermofisher Scientific, Carlsbad, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Cell culture supernatants were analyzed for secreted proteins using Immune Monitoring 65-Plex Human ProcartaPlex™ Panel for MAGPIX (Thermofisher Scientific, Carlsbad, CA) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: Epidermal growth factor receptor (EGFR) protein expression levels on the surface of Gli36-derived EVs were quantified using an EGFR Human ELISA kit (ThermoFisher Scientific, Waltham, MA). EVs were spiked in healthy donor serum at different concentrations ranging from 0 to 1.0E11 particles/mL while maintaining the serum-derived EV concentration at 1.0E9 particles/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... were determined by matching the UniProt human protein database (release 2023_01) with the acquired fragmentation pattern using Sequest (Thermo Fisher Scientific, Waltham, MA) (Eng et al. ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...