Labshake search
Citations for Thermo Fisher :
201 - 250 of 308 citations for rac Clopidogrel MP Endo Derivative 13C d3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... BSF cells and a T7 polymerase/Cas9 expressing derivative line (derived using plasmid pJ1339)128 were cultured in HMI-9 medium (Life technologies), supplemented with 10% foetal calf serum at 37 °C with 5% CO2 ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids of pET28a-his TEV-glnR or pET28a-his TEV-glnR derivative was firstly transformed into expression strain BL21(DE3) (Invitrogen, Inc.). then single colonies of the positive transformants were inoculated and amplified with 5 L LB broth supplemented with 50 μg/ml kanamycin at 37 °C with shaking ...
-
bioRxiv - Biochemistry 2024Quote: ... The genes encoding GFP-P2A-mCherry and GFP-ATP5G1ΔMTS-P2A-mCherry were cloned via restriction cloning into a pTK derivative (Thermo Fisher PI16151), under the control of the HSV TK promoter ...
-
bioRxiv - Immunology 2024Quote: ... were extrapolated by obtaining the temperature with maximal positive derivative values of the fluorescence intensity using the 7500 Fast Real-Time PCR System software (Thermo Scientific).
-
bioRxiv - Neuroscience 2024Quote: Fibrillar aSyn was labeled with an N-hydroxysuccinimide (NHS) ester derivative of the pH-sensitive dye pHrodo Red (Thermo Fisher Scientific). Unsonicated fibrils ...
-
bioRxiv - Cell Biology 2024Quote: ... two different probes were used: chloromethyl derivative of di-chloro-fluorescein diacetate (CM-DCFDA) at a concentration of 10 µM (Invitrogen, Life Technologies), and dihydroethidium (DHE ...
-
bioRxiv - Biochemistry 2024Quote: ... was determined by taking the maximum of the first derivative of the fluorescence data with respect to temperature using the Protein Thermal Shift software (Applied Biosystems). For the determination of binding affinities ...
-
bioRxiv - Biochemistry 2022Quote: ... Relative ion abundance of peptides labelled with 12C-IPA and/or 13C-IPA in extracted ion chromatograms generated using XCalibur Qual Browser software (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The reactions were then loaded onto a 1% agarose gel and electrophoresed in an Owl™ D3-14 electrophoresis box (Thermo Scientific, MA, USA) containing 1X TBE buffer for 30 min at 180 V delivered from an Owl™ EC 300 XL power supply (Thermo Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 2000) and derivatives were cultured in 4.5g/l glucose DMEM with 10% FBS and 2× NEAA (all Thermo-Fisher Scientific, Loughborough, UK). SK-MEL-28 cells (kind gift of Dr ...
-
bioRxiv - Biophysics 2021Quote: ... the spectra were analyzed with an algorithm based on a second-derivative function and a self-deconvolution procedure (GRAMS and OMNIC software, Thermo Fisher Scientific) to determine the number and wavenumber of the individual bands within the spectral range of the amide I band.
-
bioRxiv - Molecular Biology 2021Quote: ... Purified eIF1A derivatives were labeled at 4 °C with 4-fold excess of Alexa Fluor™ 555 C2 maleimide (Alexa555, Thermo Scientific) following the manufacturer’s manual ...
-
bioRxiv - Microbiology 2024Quote: ... The dried extracts were silylated to produce trimethysilyl (TMS) derivatives by dissolving in 500 µL of silylation grade acetonitrile (Thermo Scientific, TS20062), followed by addition of 500 µL of N-methyl-N-trimethylsilyltrifluoroacetamide (MSTFA ...
-
bioRxiv - Cell Biology 2024Quote: ... two different probes were used: chloromethyl derivative of di-chloro-fluorescein diacetate (CM-DCFDA) at a concentration of 10 µM (Invitrogen, Life Technologies), and dihydroethidium (DHE ...
-
bioRxiv - Biochemistry 2021Quote: ... and incubated in the same media containing either 15mM (5mM 12C+10mM 13C) glucose plus 3.2mM 12C glutamine (Gibco, Cat#25030-081), or 15mM 12C Glucose plus 3.2mM (0.7mM 12C,14N+ 2.5mM 13C,15N ...
-
bioRxiv - Cell Biology 2021Quote: ... or doubly labeled 13C-labeled lysine and 13C,15N-labeled arginine to a final concentration of 0.46 mM each with 10% FBS (Thermo Scientific Cat #89983). Cells were maintained in specific isotope conditions for a minimum of six doublings ...
-
bioRxiv - Microbiology 2023Quote: ... 13C-labeled positions and their 13C abundance were estimated by fragment patterns based on 13C-labeled standard of amino acids and an MS spectra library (mzCloud) (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2024Quote: ... and the 13C/12C ratio in the resultant CO2 was determined by isotope ratio mass spectrometer (Deltaplus XL, Thermo Scientific, Brehmen, Germany). Each experiment was performed in biological triplicates.
-
bioRxiv - Microbiology 2024Quote: ... We measured CO2 concentration and 13C signature of gas samples using a headspace gas sampler (GasBench II, Thermo Fisher Scientific, Bremen, Germany) coupled to an isotope ratio mass spectrometer (Delta V Advantage ...
-
bioRxiv - Genetics 2022Quote: ... approximately 470 base pairs surrounding the predicted dmiR-1-target site in 3’UTR of Mp were amplified directly from genomic DNA from the w1118 flies using the primers Mp-F1: ATAACTAGTTGAGCGGAAACGGAAGGAAGAAGAGGAG and Mp-R1: ATATCTAGATGTTGTGAATGATGACGTTAGG and a high-fidelity DNA Polymerase enzyme (Thermo Scientific Phusion High-Fidelity DNA Polymerase) kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... and their derivatives were cultured in DMEM containing 1 g/l glucose supplemented with 10% heat-inactivated FCS (Fetal Calf Serum, Gibco, Cat#: 10270-106), 2 mM L-glutamine (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... NulO derivatives were separated isocratically on a C18 reverse-phase HPLC column (Thermo Scientific, Hypersil ODS, 4.6 mm by 250 mm, 5 µm) using acetonitrile/methanol/water (7:9:84 vol/vol/vol ...
-
bioRxiv - Cancer Biology 2022Quote: We purchased 6-mercaptopurine monohydrate (6-MP, #AC226520050) from Thermo Fisher.
-
bioRxiv - Biochemistry 2024Quote: ... we used Refeyn Acquire MP and DiscoverMP software and NativeMarkTM (ThermoFisher) was used as standard.
-
bioRxiv - Immunology 2024Quote: ... fixed in 1.6% formaldehyde (Thermo Fisher Scientific; diluted in MP-PBS) for 10 min and stained with 125 nM Cell- ID intercalator-Ir (diluted in Maxpar Fix and Perm Buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... and live/dead staining kit consisting of acetomethoxy derivative of calcein (cAM) and ethidium homodimer (EthD) were received from Life Technologies (Grand Island, NY). QuantiChrom alkaline phosphatase (ALP ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections from P21 animals were counterstained with DAPI (Cat. # MP-01306, Invitrogen) prior to coverslipping ...
-
bioRxiv - Genetics 2024Quote: ... Bacillus strains containing pDG1664 and its derivatives inserted at thrC were grown in Lennox LB containing MLS (25 µg/mL erythromycin (Thermo Fisher Scientific, 50-213-296) and 5 µg/mL lincomycin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: Culture medium for the cardiac MPS was RPMI 1640 medium (11875-093; Gibco) supplemented with B-27 (17504-044 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a homogenizer (MP Biomedicals™ FastPrep-24, ThermoFisher Scientific, cat. no. 12079310). Samples were frozen overnight at -80 °C to allow further cell lysis ...
-
bioRxiv - Genomics 2020Quote: ... the MP Biomedicals™ FastDNA™ SPIN Kit for Soil (11492400, Fisher scientific, UK), (c ...
-
bioRxiv - Genomics 2020Quote: ... and 380 mg/L EGTA [MP] at pH 8.5) and 0.9 mL phenol/chloroform (Fisher Scientific). After phase separation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Spores were disrupted using a Fastprep-24 5G bead beater (MP Biomedicals, Fisher Scientific, Sweden) and 0.1 mm glass beads ...
-
bioRxiv - Bioengineering 2020Quote: Mitochondrial potential was analyzed in 2D monolayers and MPS using MitoTracker Red (M7512 Thermo Scientific). Live MPS and monolayer were incubated with Mitotracker for 30min at 37C in RPMI 1640 supplement with insulin ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from cells or MPs with Trizol Reagent (ThermoFisher Scientific, cat. # 1559626), and purified with the Pure Link RNA kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... The tissues were incubated with 0.5% trypsin (103139, MP Biomedicals, Inc, Thermo Fisher Scientific, Waltham, MA) in HBSS (Ca2+/Mg2+-free ...
-
bioRxiv - Bioengineering 2022Quote: ... confocal fluorescence microscopy was used for samples stained with the L/D kit (Invitrogen, MP 03224). The L/D staining solution ...
-
bioRxiv - Physiology 2023Quote: Liver samples were crushed with a FastPrep-24 Instrument (MP Biomedical, Fisher scientific SAS, Illkirch, France) in HBSS (Invitrogen ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... The tissues were incubated with 0.5% trypsin (103139, MP Biomedical) in HBSS (Ca2+/Mg2+-free) (14170112, Invitrogen) for 20 min at +37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by cell wall and DNA counterstaining using mPS-PI and Hoechst solution (5 μg/ml; Invitrogen) or SCRI Renaissance staining SR2200 ...
-
bioRxiv - Immunology 2022Quote: ... The immunoblots were developed on a BioRad Chemidoc MP system using ECL reagents (ThermoFisher and G Biosciences). Quantification was performed using ImageJ.
-
bioRxiv - Immunology 2022Quote: ... total RNA was prepared using lysing matrix D (MP Biomedical) containing 1 mL of TRIzol reagent (ThermoFisher) and homogenization at 30 s at 6.0 m/s twice using MP Biomedical Fastprep 24 Tissue Homogenizer ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue neurochemical analytes were eluted in MD-TM MP mobile phase (cat. no. 701332, Thermo Fisher Scientific) under isocratic conditions at 0.6 ml/min for 21 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein A-tagged strains were immunoprecipitated with Rabbit IgG-conjugated (MP-Biomedicals, SKU 085594) Dynabeads (Invitrogen, 14301) (Vakiloroayaei et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... MP contrast values were calibrated to molecular masses using commercial NativeMarkTM Unstained Protein Standard (Thermo Fisher, MA). The instrument was calibrated using a 30-fold dilution of NativeMark ...
-
bioRxiv - Neuroscience 2024Quote: ... cultured MPs were infected a mix of lentivirus and protamine sulfate (5 µg/mL, Thermo Fisher Scientific) to enhance lentiviral integration into the cells ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA was extracted from the liver MPS using a guanidine thiocyanate-containing lysis buffer (Invitrogen, Waltham MA) and further purified per the vendor protocol (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... and the pellets were resuspended in single-cell suspension in MP medium containing DMEM (Gibco, 41965-039) supplemented with 10% fetal calf serum (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... difficile infection by treating mice with 0.5 mg/mL cefoperazone (MP Pharmaceuticals) in sterile distilled drinking water (Gibco) ad libitum ...
-
bioRxiv - Immunology 2020Quote: ... difficile infection by placing mice on 0.5 mg/mL cefoperazone (MP Pharmaceuticals) in sterile distilled drinking water (Gibco) ad libitum ...