Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µL TaqMan Universal PCR Master Mix (2×) (Applied Biosystems), and 0.5 µL of each TaqMan Gene Expression Assay reagent ...
-
bioRxiv - Physiology 2022Quote: ... loading buffer containing 5% 2-mercaptoethanol (Fisher Scientific, O3446I-100). Samples were then subjected to SDS-PAGE on NuPAGE Novex 12% Bis-Tris gels (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal volume of SYTOX Green (5 μM final in HBSS without Ca+2/Mg+2, Invitrogen) was added to each sample and incubated in the dark for 10 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... discoideum clones on SM/5 plates (2 g glucose (Fisher Scientific), 2 g Bacto Peptone (Oxoid) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT Plus EdU Kit, Invitrogen) and 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Cell Biology 2020Quote: ... Twenty min before fixation EdU (5-ethynyl-2’-deoxyuridine, Molecular probes) was added in all the experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2×10^5 cells were lysed in RIPA buffer (Thermo Fisher) with protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with EdU (5-ethynyl-2’-deoxyuridine, Life technologies) at final concentration of 10 µM for 4 hours and then harvest to perform Click-iT reaction using Click-iT EdU flow cytometry Alexa Fluor 488 assay kit (Life technologies ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Minced tissue was digested with enzyme solution at 37°C for 60-90 min with gentle shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 µM 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Carlsbad, CA, USA); 10 µM 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Tissue was incubated with enzyme solution for 30 min at 37°C with gentle shaking ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4) supplemented with 5 μM Fura-2 AM (Thermo Fisher), 50 μM pluronic acid F-127 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen, Waltham, MA, USA) was added to the cells ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 5-ethynyl-2’-deoxyuridine (EdU; ThermoFisher A10044) dissolved in K-SFM (20 mM final concentration ...
-
bioRxiv - Physiology 2024Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 5× SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 µl of the resuspended array compound or the equivalent amount of buffer in the ligand-free control ...
-
bioRxiv - Systems Biology 2024Quote: ... 2) Blocking buffer: wash buffer with 5% BSA (Thermo Fisher, J6509722). Hs27-VPH were transduced with lentiviruses of pRCA360 expressing sgRNA against HES7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, C10636), then stained with a fluorescent CD34 antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... transferred to 5 mL of LB broth (Fisher Scientific, BP1426-2), and incubated shaking overnight at 37℃ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The resulting samples were extracted with diethyl ether and derivatized with TMS-DAM for quantification against a standard curve by GC-MS (Thermo Scientific Trace GC Ultra-DSQII) after normalization with an internal standard.
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
TOR Inhibition Enhances Autophagic Flux and Immune Response in Tomato Plants Against PSTVd InfectionbioRxiv - Plant Biology 2024Quote: ... the RNA pellet was resuspended in 44 μL of sterile Milli-Q water treated with DEPC (diethyl pyrocarbonate) and DNA contamination was eliminated using the TURBO DNA-free™ Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
bioRxiv - Pathology 2024Quote: ... according to manufacturer specifications in the presence of 10mM 5-Bromo-2’-Deoxyuridine 5’-Triphosphate (BrdUTP, Thermo Scientific, B21550), at 37°C in a dark humidified slide box for 90 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... resuspended in 2% FBS in HBSS containing 5 g/ml DAPI (Invitrogen), and sorted into DMEM containing 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... 2% hematocrit in 1640 RPMI-HEPES supplemented with 5% AlbuMAX II (GIBCO) and 0.25% gentamycin complemented with appropriate Artemisia infusion dilutions and with or with IPP and Cm ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 mg of 5-ethynyl-2’ deoxyuridine (EdU) (Thermo Fisher Scientific, A10044) was injected intraperitoneally 12 h prior to euthanasia ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μl of 2 x Novex TBE-Urea Sample Buffer (ThermoFisher Scientific) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 4h and EdU (5-ethynyl-2’-deoxyuridine from Invitrogen; 10µM final) was added 1h before cells were harvested ...