Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Microbiology 2022Quote: ... The surface of the master was treated with 1H,1H,2H,2H-perfluo-rooctyltrichlorosilane (Thermo Scientific) to promote the removal of elastomer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were split every 2-3 days through 9 minutes incubation with EDTA 50mM pH=7.4 and 3 minutes of 0.25% trypsin (Gibco).
-
bioRxiv - Biochemistry 2022Quote: ... to final concentration 0.5 mg/ml protein and 6x dye and heated from 10 to 70 °C with fluorescence reading every 0.1 °C (4 to 5 sec) in a QuantStudioTM 7 Flex Real-Time PCR System (Life Technologies). Protein thermal melting curve were generated using the Protein Thermal Shift TM software ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 cells with Fzd1/2/4/5/7/8 knocked out were provided by Michael Boutros (Voloshanenko et al., 2017) and maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gemini) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Intracellular NO production was assessed during reoxygenation by live-cell staining with the NO-sensitive fluorescent dye 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein (DAF-FM) diacetate (Invitrogen). iPSC-ECs were stained with 1 μM DAF-FM diacetate for 10 minutes at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Pathology 2019Quote: ... 4% Penicillin/Streptomycin and 2% Amphotericin B (Gibco, UK). Lung lobes were separated and sliced in chilled HBSS buffer at a thickness of 250μm using the VT1200S Vibratome (Leica ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... the samples were stained with 80 μL CellEvent Caspase 3/7 Green detection Reagent 2 µM in PBS with 5% FBS (Invitrogen, C10423) and then incubated for 30 minutes at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... To detect sinapoylmalate and intact indole-3-methyl glucosinolate (I3M) contents, an AcclaimTM RSLC120 C18 column (100 mm x 3 mm, 2.2 µm) (ThermoFisher Scientific, MA) was used in conjunction with mobile phases consisting of solvent A (0.1% formic acid (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then treated with hexamethyldisilazane-trimethylchlorosilane-pyridine solution (3:1:9; ThermoFisher) for 20 min at 110°C ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2022Quote: ... they were concentrated from 40 μl to 5 μl during 2h at low temperature using speedvac (Thermofisher). Small RNA libraries were then built with Illumina TruSeq Small RNA Sample kit following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2023Quote: ... 5 μl of 7-AAD (Invitrogen, 00-6993-50) was included for dead cell exclusion.
-
bioRxiv - Biophysics 2019Quote: ... N-((2-(iodoacetoxy)ethyl)-N-Methyl)- amino-7-Nitrobenz-2-Oxa-1,3-Diazole (IANBD ester) and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley ...
-
bioRxiv - Cancer Biology 2022Quote: ... culture medium was replaced with 100 µL full melanoma medium with 4 µM Caspase-3/7 activity dye (CellEvent, Thermo Fisher Scientific). Plates were then imaged on a Celigo Imaging Cytometer (Nexcelom ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 µl of Novec 7500 containing 20 % 1H,1H,2H,2H-perfluorooctanol (PFO; ThermoFisher Scientific GmBH, Germany) was added to the suspension and mixed by pipetting resulting in bead clustering ...
-
bioRxiv - Microbiology 2022Quote: The pellicle biofilm was stained with 5 μM SYTO 9 (Thermo Scientific), 5 μM Propidium Iodide (PI ...
-
bioRxiv - Biochemistry 2024Quote: ... were transfected with 5-9 µg of bacmid DNA using ExpiFectamine (Gibco) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were cultured for 24 hours in culture medium supplemented with 0.5% (w/v) methyl cellulose and B-27 (1/50, Life technologies).
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Plant Biology 2020Quote: ... Chlorophyll content (chlorophyll a and b) was quantified with the NanoDrop One Spectrophotometer (ThermoFisher) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mL B-27 Supplement (Thermo Fisher Scientific, 17504044), 2.5 mL GlutaMAXTM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FCS and 2% B-27 (Gibco) and maintained at 5% CO2 and 37°C in humidified incubators ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Immunology 2024Quote: ... 7-amino-4 chloromethylcoumarin (CMAC) CellTrakerTM (Invitrogen, C2110, 0.1 µM); Vybrant CFDA SE Cell Tracer Kit-Carboxyfluorescein diacetate succinimidyl ester (CFSE ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: Sodium salt of 3-methyl-2-oxobutanoic acid (KIV; cat # AC189720050) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2021Quote: ... and Heparin scaffold conditioned media groups (n=5) across 21 days (Days 0, 3, 7, 14, 21) using a RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific). RNA was then reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: 10 uL of either Caspase-3 or −7 library glycerol stocks was used to inoculate 5 mL of auto-induction media (Invitrogen Magic Media) and allowed to incubate and express for 18 hours at 30 °C ...
-
bioRxiv - Developmental Biology 2021Quote: Preparation of lipid/cholesterol depleted fetal bovine serum (FBS): 500mL FBS were stirred overnight at 4°C with 10g Cab-osil M-5 (ACROS Organics 7631-86-9). The mix was then centrifuged for 10min at 3000rpm and the supernatant filtrated under sterile conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cells were plated at 2-3×106 cells/ml in primary B cell medium (DMEM (Gibco) containing 10% FBS (Sigma) ...