Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 6 Methoxy 2 methyl 1H benz de isoquinoline 1 3 2H dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: 4T1 and 67NR cells at 70-80% confluence were transfected with the shRNA constructs described above in FuGene 6 at a ratio of 3:2 per manufacturer’s instructions (Thermo Fisher). Pools of transfected cells were selected in media with 7 µg/ml puromycin ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Pathology 2024Quote: ... Cells were subcultured at a 1:3 to 1:6 ratio using Gibco TrypLETM Express Enzyme (12605010, Fisher Scientific) for cell dissociation ...
-
bioRxiv - Microbiology 2019Quote: ... and 2 μl of 1 μM ToPro 3 (Molecular Probes T-3605), a nucleic acid dye that only permeates cell membranes of dead cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Pak1-2-3 (pSer141) (44-940G, 1:2000) from Invitrogen/Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... phospho-PAK1/2/3 (Thr402) (ThermoFisher PA1-4636, 1:1000 for WB), phospho-PAK4 (Ser474)/PAK5 (Ser602)/PAK6 (Ser560 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... and for nuclei with DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; Invitrogen; 1:500). The antigen-antibody complex was visualized using the secondary antibodies dk anti-ms Rhodamine (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... along with 1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen; cat#: 62248) to stain the nuclei and Alexa Fluor 647 phalloidin at 1:100 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 1:10,000 DAPI (4’,6-diamino-2-fenilindol, Molecular Probes), mounted with Prolong Diamond Antifade Mountant (Molecular Probes ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI 1:20000, Fisher Scientific) for 5 minutes before being washed ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:2000) for 10 min and washed with PBS three times before mounting onto slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Molecular Probes DAPI (4’,6 Diamidino 2 Phenylindole, Dihydrochloride) (1:500, Thermo Scientific, D1306).
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4′,6-diamidino-2-phenylindole solution (DAPI, 1:10000, Invitrogen) before being washed in PB 0.05 M and mounted on slides using chromium (3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA were stained with 1 µg/ml 4′′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with 1:1000 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen) for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... After counterstaining with 4′,6-diamidino-2-phenylindole (DAPI, 1:5,000, #62248, Thermo Scientific), slides were mounted using ProLong Gold Antifade Mountant with DAPI (#P39941 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI,1:20000, Invitrogen D3571) diluted in PBS to visualize cell nuclei (data not shown) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Water extractable halides were measured using an ion chromatograph (Dione ICS-2100, Thermo Scientific). Soil (10 g ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Sections were counterstained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI) (1 mg/mL, Thermo Scientific).
-
bioRxiv - Molecular Biology 2019Quote: ... miR-125b+A or control RNA 3’O-methyl-modified mimic using 5 μl Lipofectamine 2000 (Life Technologies) in a 500 μl reaction mixture according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0-2h embryos were homogenized in Trizol (Invitrogen) and RNA was extracted per manufacturer’s directions ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: Isolated colonic crypts or organoids were loaded at RT with Fura-2/AM (5 μm, 2h; Thermo Fisher Scientific) in HBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... methyl pyruvate (Thermo Scientific™), methyl aspartate (Santa Cruz ...
-
bioRxiv - Cell Biology 2019Quote: ... methyl ester (TMRM; ThermoFisher Scientific) staining using a microplate reader ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... methyl ester (TMRM) (Thermo Fisher) to visualize active mitochondria ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... methyl ester (TMRM) (ThermoFisher, I34361) to visualize active mitochondria ...
-
bioRxiv - Pathology 2023Quote: Tetramethylrhodamine methyl ester (TMRM) (Invitrogen) in self-quenching mode (1.5 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... 2h) conjugated to AF-568 (1:500 goat-anti-rabbit, Life Technologies #A11011; RRID: AB_143157) or AF-647 (1:500 goat-anti-mouse ...
-
bioRxiv - Developmental Biology 2020Quote: ... After blocking for 2h at RT in CAS-Block (1:10 in PBST; ThermoFisher, #008120) blocking reagent was replaced by antibody solution (diluted in CAS-Block ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 30 μL of N-methyl-N-trimethylsilyltrifluoroacetamide plus 1% trimethylchlorosilane (MSTFA + 1% TMCS, Thermo Scientific) was added to the MSTFA vials ...
-
bioRxiv - Cell Biology 2022Quote: ... Vitronectin coated plates (Life Technologies, A14700, 1:100 in DPBS 1h at RT) were used to culture BIONi010-C iPSCs with StemFlex medium (Fisher scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...