Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Methoxy 2 methyl 1H benz de isoquinoline 1 3 2H dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Microbiology 2022Quote: ... The surface of the master was treated with 1H,1H,2H,2H-perfluo-rooctyltrichlorosilane (Thermo Scientific) to promote the removal of elastomer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 µl of Novec 7500 containing 20 % 1H,1H,2H,2H-perfluorooctanol (PFO; ThermoFisher Scientific GmBH, Germany) was added to the suspension and mixed by pipetting resulting in bead clustering ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Bioengineering 2019Quote: ... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... 10% Donkey Serum, 1% Triton-100, 1h) followed by primary (overnight, 4°C) and secondary antibodies (1-2h, Jackson ImmunoResearch or ThermoFisher Scientific) incubation ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunolabeling with performed with mouse anti-B23 primary antibody (1:300; 2h) then detected with Alexa 488 donkey anti-mouse antibody (Invitrogen; 1:500; 1h), then further fixed with 4% paraformaldehyde in DEPC-PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... for 2h at RT followed by a 1h incubation with 1:200 secondary goat anti-rabbit antibody Alexa 647 (Thermo Fisher, A32733) and DAPI to visualize cell nuclei ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.173% 2-methoxy(polyethyleneoxy)propyltrimethoxysilane (Gelest, SIM6492.7) and 0.62% n- butylamine (Acros Organics) with flowing nitrogen gas for 90 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... the retinal sections were mounted with Fluoromount G™ containing 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI, Invitrogen) for nuclei detection ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Cell Biology 2023Quote: ... and His6-tagged VASP (Benz et al., 2009) using Lipofectamine 2000 (Invitrogen, Karlsruhe, Germany). Cells were lysed in buffer A (40 mM HEPES-NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried material was dissolved in 300 μl of 6:1 (v/v) of methyl sulphoxide D6 (99.9% atom D + 1% tetramethylsilane, ACROS Organics):D2O (100% atom D ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI) and appropriate secondary antibodies conjugated to fluorochromes (Thermo Fisher Scientific) were applied for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Neuroscience 2023Quote: ... A-21449 RRID:AB_2535866) (1:500, 2h incubation; Invitrogen, Canada). Slices were mounted on charged microscope slides (Superfrost/Plus ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Neuroscience 2022Quote: ... RRID: AB_10541045) for 3 days at 4°C followed by 2h in 1:800 anti-mouse FluoroNanogold (Life Technologies, A24920) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...