Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Microbiology 2024Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Invitrogen). This process ...
-
bioRxiv - Genetics 2024Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). For Figure 5A and C and Figure 6 ...
-
bioRxiv - Genetics 2024Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). For Figure S7 ...
-
bioRxiv - Microbiology 2024Quote: ... and 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) solution (Invitrogen) for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, UK) and Phalloidin-555 or 647 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were DAPI (4′, 6-diamidino-2-phenylindole; Thermo Fisher) stained and mounted on microscopy slides using Prolong Diamond antifade Mountant (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... added with DAPI (4′,6-diamidino-2-phenylindole, Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Cas. No. 28718-90-3, Thermo Scientific GmbH, Germany), Tween 20 (Art ...
-
bioRxiv - Molecular Biology 2022Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2024Quote: ... and passaged every 4-5 days with 1 mg/ml Dispase (Gibco). The human FUSWT line ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were washed extensively with PBS and activated via photoirradiation (365 nm, 0.8 mW for 5 minutes) with sulfosuccinimidyl-6-4’-azido-2’-nitrophenylamino hexanoate (Sulfo-SANPAH; Thermo Scientific Pierce). To do so ...
-
bioRxiv - Immunology 2024Quote: ... For T cell panels (Supplemental table 2, 4, 5, 6) we fixed cells with the FOXP3 Fixation/Permeabilization Buffer Kit (Thermo Fisher) and conducted intracellular/nuclear stains using the FOXP3 Permeabilization Buffer (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2022Quote: ... 4-Chlorobenzenesulfonate Salt (DID) and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Carlsbad, CA, USA). Ammonium bicarbonate ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were washed 4 times with PBST and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Microbiology 2024Quote: ... for 1 h at 4°C.The DynaMag™-2 magnetic rack (Thermo Fisher Scientific) was used for flow-through removal and washing ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was visualized using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA ...
-
bioRxiv - Genomics 2022Quote: Total RNA was extracted separately from testes (n = 4) and ovary (n = 4) tissues using TRIzol (Invitrogen). For each sample ...
-
bioRxiv - Evolutionary Biology 2024Quote: Total RNA was extracted separately from testes (n = 4) and ovary (n = 4) tissues using TRIzol (Invitrogen). For each sample ...
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... along with 1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen; cat#: 62248) to stain the nuclei and Alexa Fluor 647 phalloidin at 1:100 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 1:10,000 DAPI (4’,6-diamino-2-fenilindol, Molecular Probes), mounted with Prolong Diamond Antifade Mountant (Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:2000) for 10 min and washed with PBS three times before mounting onto slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Molecular Probes DAPI (4’,6 Diamidino 2 Phenylindole, Dihydrochloride) (1:500, Thermo Scientific, D1306).
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4′,6-diamidino-2-phenylindole solution (DAPI, 1:10000, Invitrogen) before being washed in PB 0.05 M and mounted on slides using chromium (3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...