Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; Molecular Probes). Pictures were taken using a TCS SP5 Inverted confocal (Leica ...
-
bioRxiv - Genetics 2021Quote: ... Tissue slides were also stained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) to visualize the total number of nucleated myocardial cells within each section ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated in 4’,6-diamidino-2-phenylindole (DAPI, Acros Organics–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were counterstained using 4’,6-Diamidino-2-Phenylindole (DAPI – Life Technologies, D1306) diluted in PBS before being mounted on microscope slides with ProLong Gold Antifade Mountant (Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... the DNA was counterstained with DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific) diluted 1:10,000 with PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Fluoromount-G mounting medium with 4′,6-diamidino-2-phenylindole (Invitrogen, Waltham, MA) was used to mount the samples.
-
bioRxiv - Microbiology 2023Quote: ... Cells were mounted with ProLong and 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen) and imaged using a Zeiss Imager M2 Plus wide field fluorescence microscope ...
-
bioRxiv - Genomics 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI Thermo Fisher Scientific) and AlexaFluor 555 anti-mouse (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and 300 µM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; FluoroPure grade; D21490, Thermo Scientific) were used to fix and stain the nuclei ...
-
bioRxiv - Neuroscience 2024Quote: ... All sections were counterstained with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher) before mounting.
-
bioRxiv - Cell Biology 2024Quote: ... Cell nuclei were labeled with dapi (4 ’, 6-diamidino-2-phenylindole, Invitrogen, P36931). Images were obtained in the Zeiss LSM 800 Confocal Optical Microscope at Centro de Micro y Nanoscopía de Córdoba (CEMINCO-CONICET-UNC ...
-
bioRxiv - Genetics 2023Quote: ... For each 6-well added 2 mL of 4% PFA (cat#28906 Thermofisher) in PBS (cat#10010-023 Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300 μM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei.
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) diluted 1:1000 in phosphate-buffered Saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62248). The percentage of infected cells at each time point was quantified using ImageJ software.
-
bioRxiv - Molecular Biology 2023Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei were stained with DAPI (4’,6-diamino- 2-phenylindole, dihydrochloride, Thermofisher, #D3571) solution (0.5 mg/ml) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). The preparations were analyzed under a confocal microscope Zeiss 510 LSM META and Zeiss 780-NLO (Carl Zeiss Microscopy ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific).
-
bioRxiv - Developmental Biology 2022Quote: ... briefly washed with PBST and DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific) was added to PBST at a 1 in 1000 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... dried and stained with 10 μM 4’,6-diamino-2- phenylindole (DAPI) (Invitrogen). After another round of PBS wash ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1X PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections were counterstained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; Invitrogen; D1306) and cover-slipped with Fluoromount-G (Southern Biotech ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI, 62247, ThermoFisher Scientific) for 2 minutes at 1:2000 dilution in 1X PBS ...
-
bioRxiv - Genetics 2024Quote: ... germlines were stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Germlines were mounted in Vectashield (VectorLabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were stained with DAPI (4′,6-Diamidino-2-phenylindole dihydrochloride) (Thermofisher Scientific) in PBS for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear stain: 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2ng/ml; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Bioengineering 2024Quote: ... All samples were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) to visualize cell nuclei.
-
bioRxiv - Microbiology 2024Quote: ... France) and DNA was counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) and polysaccharide content (wheat germ agglutinin labeled with fluorescein ...
-
bioRxiv - Bioengineering 2024Quote: ... slides were incubated with DAPI (4’,6-Diamidino-2-Phenylindole) (Life Technologies, USA) dye (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA was stained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Coverslips were then mounted on slides using ProLong™ Gold Antifade mounting medium (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2024Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole) and/or Rhodamine Phalloidin (Invitrogen™ R415). for 2 hr at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated at room temperature for 4-5 h in Triton PBS containing Alexa Fluor 594-conjugated donkey anti-rabbit IgG (1:1000; A-21207, Thermo Fisher Scientific, RRID:AB_141637). After binding of streptavidin/antibodies ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 4 h and DAPI (Thermo Fisher Scientific) staining was used to visualize cytoarchitecture (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... using sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate reagent (ThermoFisher Scientific, USA) in accordance to manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... Sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SSMCC) was purchased from ThermoFisher Scientific (Rockford ...