Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) with standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... and a QuantStudio 6 Flex Real Time PCR system (Thermo Fisher) using RNA pol2 as an internal control ...
-
bioRxiv - Neuroscience 2022Quote: ... in a StepOne Real-Time PCR system (Applied Biosystems, Warrington, UK) under the cycling conditions ...
-
bioRxiv - Physiology 2022Quote: ... in a Quant Studio 5 Real-Time PCR System (Applied Biosystems, ThermoFischer Scientific AG ...
-
bioRxiv - Neuroscience 2022Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Applied Biosystems). qPCR results comparing the injected and uninjected hemispheres were analyzed using the ΔΔCT methods and normalized to Actb ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR was performed with QuantStudio™ 5 (Thermo Fisher).
-
bioRxiv - Neuroscience 2022Quote: ... and run on a StepOnePlus Real-Time PCR System (Applied Biosystems). Primer sequences used for Neil3 were GGGCAACATCATCAAAAATGAA forward and CTGTTTGTCTGATAGTTGACACACCTT reverse ...
-
bioRxiv - Microbiology 2022Quote: ... using the QuantStudio™5 Real-Time PCR system (Applied Biosystems), which has been described in detail (31) ...
-
bioRxiv - Microbiology 2022Quote: ... and the Applied Biosystems 7300 Real-Time PCR system (Thermo Fisher). The thermal profile was 95 °C for 30 s ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we performed a qPCR (Thermo Scientific PikoReal Real-Time PCR System). Extraction and library blanks were run alongside all samples to check for the presence of contamination ...
-
bioRxiv - Physiology 2022Quote: ... with the QuantStudio 6 Flex Real-Time PCR system (Thermo Scientific).
-
bioRxiv - Developmental Biology 2022Quote: ... and QuantStudio™ 3 Real-Time PCR System (Applied Biosystems A28567). All primers used in qRT-PCR had primer efficiencies above 98% ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the Step One Plus Real-Time PCR System (Applied Biosystems). Relative quantification was achieved by normalizing to the expression levels of Beta-2-Microglobulin (B2m ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2024Quote: ... ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA), and Software 7500 v.2.0.6 were used for qRT-PCR and gene expression analysis ...
-
bioRxiv - Pathology 2024Quote: ... on a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and analyzed using 7500 Fast Real-Time PCR System (Applied Biosystems). Primers for human genes were designed using the Primer Blast application from NCBI (see Key resources table) ...
-
bioRxiv - Biophysics 2024Quote: ... monitored using a 7900HT Fast Real Time PCR System (Applied Biosystems). The fluorescence was normalized based on the peak value ...
-
bioRxiv - Physiology 2024Quote: ... and on a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The primers were all purchased from Millipore Sigma with sequences listed as below ...
-
bioRxiv - Physiology 2024Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The Rplp0 mRNA was used as a loading control ...
-
bioRxiv - Neuroscience 2024Quote: ... A ViiA™ 7 Real-Time PCR System (Applied Biosystems. USA) was used to perform RT-qPCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... on a 7900HT Real-Time PCR instrument (Thermo Fisher Scientific, 10966). The housekeeping gene Actb was used as the reference ...
-
bioRxiv - Molecular Biology 2024Quote: ... in StepOneTM or ViiATM 7 Real-Time PCR Systems (Applied Biosystems). All PCR reactions were done with technical duplicates or triplicates and then normalized to the GAPDH housekeeping gene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Assays were run on StepOnePlus Real-Time PCR system (Applied Biosystems). Tcp1 was used for input and differentiation stage normalization ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Step One plus Real-time PCR system (Applied Biosystems).
-
bioRxiv - Developmental Biology 2024Quote: ... using the StepOnePlus 96-well Real-Time PCR System (Applied Biosystems). Reactions with cDNA samples were prepared using a mixture of 2X SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were analysed with a StepOne real-time PCR machine (ThermoFisher) in duplicates using SYBR Green qPCR master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... in a Quant Studio 5 Real-Time PCR System (Applied Biosystems, ThermoFischer Scientific AG ...
-
bioRxiv - Microbiology 2024Quote: ... on a Step One Plus Real-Time PCR system (Applied Biosystems). The primer and probe sequences were ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are indicated in Appendix Table 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... performed via the ABI StepOnePlus Real-Time PCR System (Life Technologies), preceded the initiation of the sequencing process ...
-
bioRxiv - Bioengineering 2023Quote: ... using Real-Time PCR (Polymerase Chain Reactions) System (ThermoFisher Scientific, Australia). A list of primers (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed using TaqMan assays (Thermo Fisher Scientific) on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). The data were normalized using actin (Solyc11g005330 ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific). Standard cycling parameters were used ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... on an ABI StepOne Plus Real-time PCR System (Applied Biosystems). Ten ng of total RNA were loaded and a standard curve was used to quantify OrV ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems). Relative mRNA abundance in different time points were normalized to time points 0 hr (2-(△Ct −△Ct0) ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Microbiology 2024Quote: ... with the 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2024Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The primers are listed in Supplemental Table 3 ...
-
bioRxiv - Immunology 2024Quote: ... and the StepOnePlus Real-Time PCR system (Thermo Fisher, Waltham, MA) was utilized for measurement ...
-
bioRxiv - Bioengineering 2023Quote: ... Assays were run in StepOne Real-time PCR systems (Applied Biosystems) using the following program ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... QuantStudio™ 6 flex Real-Time PCR System (Applied Biosystems: 4485691).
-
bioRxiv - Biochemistry 2024Quote: ... in a Quantstudio 12K Flex real time PCR system (Applied Biosystems). Primers used for RT-PCR are listed in Table S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed with the SYBR GreenER SuperMix (Invitrogen) on the QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... using a 7500 Fast Real-Time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific). The 2- ΔCt method was used to analyze the data using GAPDH and tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real time quantitative PCR was performed (Cat. No. 4385610, Applied Biosystems), and target gene transcript expression was normalized to Rn18s using the ΔΔCT method ...
-
bioRxiv - Plant Biology 2023Quote: ... via a Real-Time PCR System (ABI StepOnePlus, Applied Biosystems, USA). Primers for qRT-PCR were designed using Primer Prime Plus 5 Software Version 3.0 (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Applied Biosystems, A28567). Primers for Nos2 and B2m were designed using NCBI PrimerBlast84 ...