Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 3282 citations for GPX6 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with plasmid DNA (2.5 μg/106 cells) or siRNA (50 nM) using Lipofectamine 2000 (Invitrogen) or Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... ORP8 and PTPIP51 knockdowns in HeLa cells were performed by transfection of siRNA oligos using oligofectamine (Life Technologies) for 5 hours in serum depleted medium (Opti-MEMTM ...
-
bioRxiv - Cell Biology 2020Quote: ... which was performed using a 1:3 ratio of 100 nmol/L siRNAs with Lipofectamine 2000 reagent (Invitrogen) diluted in OptiMEM (Gibco ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 pmoles of each siRNA pool were mixed with 0.1 μL RNAiMAX transfection reagent and OptiMEM (Thermo Fisher) in a total volume of 10 μL ...
-
bioRxiv - Cell Biology 2021Quote: The design of the siRNA sequences was performed using the application BLOCK-ITTM RNAi Designer (Thermo Fisher Scientific). We provided the nucleotide sequence of the genes of interest ...
-
bioRxiv - Systems Biology 2021Quote: ... siRNA’s transfections in 12-well plate for expression and cytokine profiling was carried out using Lipofectamine RNAiMax (Invitrogen) according to manufacturer instructions.
-
bioRxiv - Neuroscience 2020Quote: Transfection of cells with siRNA was performed via lipofection using Lipofectamine 2000 or Lipofectamine 3000 (Thermo Fisher Scientific), according to the manufacturer’s protocol and as described in Zimmer et al ...
-
bioRxiv - Microbiology 2021Quote: ... 2×104 iBMDMs (6-well plates) were transfected in suspension with 20 nM siRNA using Lipofectamine RNAiMAX (Invitrogen) in 200 μ Opti-MEM I (ThermoFisher).AllStars negative-control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... were plated in 12 well plate and final 50 nM siRNAs were reverse-transfected using Lipofectamine RNAiMAX (Invitrogen) and ON-TARGETplus SMARTpool siRNAs (Horizon Discovery) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and control siRNA (IDT) were transfected into the Bear cell line using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA) by following the manufacturer’s recommendations (Supplementary Tables 1 and 3) ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T and HeLa cells were transfected with a final concentration of 20 nM siRNAs using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... A standard protocol for transfection was used combining 3.3 µl of 30 µM siRNA with 1.5 µl of Lipofectamine 2000 (Invitrogen). Cells were examined by light microscopy 48 hours post-transfection.
-
bioRxiv - Biochemistry 2022Quote: The transfection of siRNA was achieved with the use of Lipofectamine RNAiMAX (Thermo Fisher Scientific, catalog number 13778075) with a final concentration of 50 nM siRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected with 25 nM siRNA using Lipofectamine 3000 without p3000 reagent according to manufacturer instructions (ThermoFisher). Following 48 to 72h post-transfection ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells (1.0 × 106) were transfected with human siRNA (10 nM) using Lipofectamine 3000 (Invitrogen, Waltham, MA). All siRNAs were ON-TARGETplus SMARTpool (Dharmacon ...
-
bioRxiv - Molecular Biology 2021Quote: Transfection of small interfering RNA (siRNA) was carried out using Lipofectamine RNAiMAX according to the manufacturer’s instructions (Invitrogen). For siRNA transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA/miRNA transfection for all cell lines was conducted with Lipofectamine RNAiMAX reagent following the manufacturer’s instructions (Invitrogen) and using a ratio 10pmol:2μL RNA:Lipofectamine RNAiMAX ...
-
bioRxiv - Biochemistry 2020Quote: U2AF2 levels were reduced by transfection of HEK 293T cells with Stealth™ siRNA HSS117616 (Thermo Fisher Sci.) and compared to a “lo GC” negative control Stealth™ siRNA using JetPrimeR Polyplus-transfection as instructed by the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... VHS40789) and a nonspecific control siRNA duplex with similar GC content (siCtrl; Medium GC Duplex #2) from Invitrogen. siRNAs against MCM5 were designed according to a previous report (Ge et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA interference was performed using a commercial siRNA for TBX1 or VEGFR3 (ON-TARGETplus SMARTpool, Thermo Fisher Scientific) (40 nM ...
-
bioRxiv - Cell Biology 2022Quote: Co-transfection of SPLICSNU-MT plasmids and siRNAs for HOIP silencing was performed using Lipofectamine 3000 (Thermo Fisher). 400,000 HeLa cells/well were seeded on a 6-well plate in the evening ...
-
bioRxiv - Genomics 2019Quote: ... ESCs were cultured in M15 medium and transfected with 50 nM siRNA using Lipofectamine 2000 (Thermo Fisher, 11668019) at day 0 and collected after 48 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control (Cat#D-001810) and SMURF2 (Cat#D-007194) small interfering RNA (siRNA) were purchased from Thermo Fisher Scientific (Lafayette ...
-
bioRxiv - Immunology 2019Quote: ... M-MØ (1 × 106 cells) were transfected with AhR-specific siRNA (siAhR) (50 nM) (# s1199, Thermo-Fisher Scientific), using HiPerFect (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: All cells were transfected with siRNAs for a 20 nM final concentration using Lipofectamine RNAimax (Invitrogen™, 13778030) when plated ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with 50 nM non-target or ATP6V0C or tetherin siRNA with Oligofectamine transfection reagent (Invitrogen) in serum-free DMEM ...
-
bioRxiv - Cancer Biology 2019Quote: ... according to the manufacturer’s instructions using following siRNAs: siControl (Silencer Select Negative Control No. 1, Thermo Fisher Scientific), siNRF2 #1 (n290469 ...
-
bioRxiv - Cell Biology 2019Quote: HMVEC-Cs were transfected with siRNA using Opti-MEMTM I Reduced Serum Medium (31985070, ThermoFisher Scientific, Waltham, MA) and Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2019Quote: ... NRCMs were transfected with small interfering RNA (siRNA) specific for programmed cell death 4 (PDCD4) (Thermo Fisher Scientific), 10-nM mirVana hsa-miR-21 specific inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA knockdown of AC1 and AC9 expression in HEK293 cells was carried out using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNAs were transfected into NSC-34 or N2A cells using Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific, 13778-075) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Cells were transfected with siRNAs synthesized by Integrated DNA Technologies (IDT) using RNAiMax Transfection reagents (Thermo Fisher Scientific) recommended by the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: 293T cells were transfected with 10 nM of each siRNA using the lipofectamine RNAiMAX transfection reagent (ThermoFisher Scientific), according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with siRNA by combining 10µl of 20µM siRNA and 5µL Dharmafect (Dharmacon, T-2001-03) in 800µL OptiMEM (Gibco, 31985-062) and adding to a 6-well plate in RPMI media to a total volume of 4mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... primary CM and H9c2 cells were transfected with short interfering RNA (siRNA) at 10nM using Lipofectamine RNAimax (Invitrogen) 24h and 48h after plating and analyzed at 96h ...
-
bioRxiv - Molecular Biology 2021Quote: ... HepG2 and Huh-7 cells were transfected with miRNA or siRNA using LipofectamineTM RNAiMAX transfection reagent (ThermoFisher Scientific) according to the manufacturer’s instructions and following experiments were performed 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: The expression of proteins of interest was suppressed using 83 nM siRNA and lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... siRNAs (3μl of 10μM conc.) and RNAiMax (7 μl) were mixed separately with 75 μl Optimem (Thermofisher, 31985062). Knockdown was initiated by mixing both siRNA and RNAiMAX suspensions together ...
-
bioRxiv - Microbiology 2022Quote: iSLK.219 cells were transfected while in suspension (reverse transfection) with 10 nM siRNAs (purchased from Thermo Fisher) against STING (HSS139156) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transient transfection was performed using 30 nmol/L siRNA or 25 nmol/ L ASO and Lipofectamine RNAiMAX (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... siRNA transfection was performed at a final concentration of 10 nM using Lipofectamine RNAiMAX transfection reagent (Invitrogen, 13778500) and Opti-MEM (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... HK2 cells were plated in 24well-plate and then transfected with siRNA using Lipofectamine RNAiMax (Thermo Fisher Scientific). For each well to be transfected ...
-
bioRxiv - Cell Biology 2022Quote: ... or the scrambled negative control siRNA was used at a final concentration of 20 nM (Thermo Fisher, AM4611), and were transfected into cells using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: RNAi experiments were performed according to manufacturer’s instructions with 25 nM double stranded siRNA and Lipofectamine RNAiMax (Invitrogen). Depending on the experiments the cells were harvest after 48 to 96 h after RNAi ...
-
bioRxiv - Microbiology 2022Quote: ... Cytotoxicity of siRNA treatment was determined by replacing cell media with a 1:10 dilution of alamarBlue (ThermoFisher) in appropriate cell culture media and incubating for 1-2 hrs ...
-
bioRxiv - Microbiology 2022Quote: ... left over-night for adherence and then transfected with the siRNAs (50 nM) using the Lipofectamine RNAiMAX (Invitrogen) transfection reagent ...
-
bioRxiv - Microbiology 2022Quote: ... 60 pmol of siRNA were mixed with 1.5 μl Lipo3000 in 50 μl of OPTIMEM (Gibco Life Technologies) without serum for 15 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 60 pmol of siRNA were mixed with 1.5 μl Lipo3000 in 50 μl of OPTIMEM (Gibco Life Technologies) without serum for 15 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... U2OS cells were transfected with a mixture of three Stealth™ siRNA duplex oligonucleotides (Invitrogen; HSS123763, HSS123765, HSS182809) at a concentration of 10 nM each ...