Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... counted with a haemocytometer to a concentration of 5 × 10^5 cells/mL and seeded into 96-well microplate (Nunc, Thermo Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... The peptides were first trapped for 1 min at 30 μl/min with 100% buffer A on a trap (0.3 mm by 5 mm with PepMap C18, 5 μm, 100 Å; ThermoFisher Scientific); after trapping ...
-
bioRxiv - Microbiology 2022Quote: ... The barcode region was amplified from the isolated DNA using forward (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCATCATGAACAATAAAACT GTCTGC3’) and reverse (5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGA CGATGACGGGCTGGTC3’) primers using Phusion high fidelity polymerase (ThermoFisher Scientific) for 20 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... Tryptic peptide mixtures were injected automatically and loaded at a flow rate of 30 μl/min in 0.1 % trifluoroacetic acid in HPLC-grade water onto a nano trap column (300 μm i.d. × 5 mm Pre collumn, packed with Acclaim PepMap100 C18, 5 μm, 100 Å; Thermo Scientific). After 3 minutes ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: Dictyostelium discoideum cells were maintained in Hans’ enriched HL-5 media (1.4X HL-5 media with 8% FM, penicillin and streptomycin) at 22°C in petri dishes (Fisher Scientific; FB0875712). A full list of strains used in this study can be found in Appendix Table S3.
-
bioRxiv - Neuroscience 2023Quote: ... first onto an Acclaim PepMap100 C18 LC Column (5 mm Å∼ 0.3 mm i.d., 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 μL min−1 maintained at 45 °C and then then separated on 50 cm RP-C18 µPAC™ column (PharmaFluidics) ...
-
bioRxiv - Neuroscience 2023Quote: ... embryos were manually dechorionated and placed in either 5 mL of egg water (control group) or 5 mL of 40 µM MK-801(Fisher Scientific) in egg water ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.1% [v/v] TFA and injected onto a C18 Pep-Map100-trapping column (Thermo Scientific, 0.3 x 5 mm, 5 μm) connected to an in-house packed C18 analytical column (Dr Maisch GmbH ...
-
bioRxiv - Cell Biology 2024Quote: ... the antibiotic selection was performed for at least 5 days using expansion media containing 5 µg/ml blasticidin S (Gibco, A1113903). hiPSC-CMs were kept in expansion media for another 2-3 days to allow cell recovery and then cultured in maturation media for at least 21 days before split into matrigel-coated white 96-well plates (Greiner Bio-One ...
-
bioRxiv - Immunology 2023Quote: ... contaminating red blood cells were lysed by resuspending cells for 5 minutes in 5 mL of ice-cold ACK Lysis buffer (Gibco, A1049201). The cells were then pelleted at 500 x g for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: Epimastigotes and trypomastigotes lysates containing 2 x 107 parasites in 20 µL of SDS-PAGE sample buffer containing 5 mM DTT were boiled for 5 min and loaded onto precast Novex Value 4-12% Tris-Glycine gels (Thermo Fisher). The electrophoresis was performed in 50 mM MOPS-50 mM Tris Base ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dried down protein Samples were further desalted online (PepMAP C18, 300 µm x 5 mm, 5 µm particle, Thermo Fisher Scientific) for 1 min (flow rate of 20 µL/min and separated on an EASY-Spray column ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (Thermo Scientific), and separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Neuroscience 2023Quote: ... then 5 min in PBS and incubated for 30 min in 5 µg/µl Alexa 647-conjugated bungarotoxin (Thermo Fisher Scientific) dissolved in 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was synthesized from 5 μg of total RNA using oligo dT18 primer (5 μM) and SuperScript III (Thermo Scientific 18080044). Quantitative PCR was performed using the gene specific primer sets (Table S2 ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 5 min with 25 pM (single-label) or 5 pM (dual-label) biotin-tagged α-FLAG monoclonal antibody (ThermoFisher Scientific #MA1-91878-BTIN ...
-
bioRxiv - Immunology 2023Quote: ... Spleens were mashed through a 70 μm filter with 5 mL DMEM with 5% FBS and 1% Penicillin/Streptomycin (Life Technologies). Before excising lungs ...
-
bioRxiv - Biophysics 2023Quote: ... membranes were immediately trimmed and placed in either 5% non-fat milk or 5% BSA in 1X TBS supplemented with 1% Tween (Thermofisher #1706475) (TBST ...
-
bioRxiv - Microbiology 2023Quote: ... Columbia colistin and nalidixic acid (CNA) agar with 5% sheep blood (5%SB-CNA) and chocolate agar medium agar plates were purchased from Fisher Scientific.
-
bioRxiv - Cancer Biology 2023Quote: ... HeLa Kyoto and RPE1 cells were treated with 5 pmol siRNA that was preincubated for 5-10 minutes in Opti-MEM Reduced Serum Media (Gibco, 31985062) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a non-targeting control siRNA (siGENOME Non-Targeting siRNA 5, Horizon Discovery, # D-001210-05-05) and 5 µl Lipofectamine RNAiMAX (Invitrogen, #13778075) in a total volume of 2 ml in antibiotics free 10% DMEM ...
-
bioRxiv - Cell Biology 2024Quote: ... The peptide mixtures were loaded onto a C18 trap column (PepMap Neo Trap Cartridge, ID 0.3 mm x 5 mm, particle size 5 μm, Thermo Fisher Scientific) and fractionated through the C18 analytical column (Aurora ...
-
bioRxiv - Cell Biology 2024Quote: ... Analysis of total 5-methyl-2ʹ-deoxycytidine (5-mdC) concentrations was performed using a Q exactive mass spectrometer (Thermo Fisher Scientific), equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Cancer Biology 2024Quote: ... EDTA was added to the samples at a final concentration of 5 mM and the suspension was diluted 1:5 in collection buffer (2 % heat-inactivated fetal bovine serum, Life Technologies; 26140079 ...
-
bioRxiv - Molecular Biology 2024Quote: ... High titer wild-type or mutant Churi was mixed with the culture at MOI of 5 and incubated at 30°C for 20 minutes before adding 5 µM SYTOX Green Nucleic Acid Stain (Thermo Fisher). Next ...
-
bioRxiv - Biochemistry 2024Quote: ... The qRT-PCR reaction with 5 μl cDNA (4ng/μl) and 7.5 μl SYBR®Green PCR Master Mix (5 mL) (Applied Biosystems) was performed on a Bio-Rad CFX connect real-time system (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptide mixtures were injected onto a C18 trap column (PepMap Neo Trap Cartridge, ID 0.3 mm x 5 mm, particle size 5 μm, Thermo Fisher Scientific) and subsequently fractionated by C18 reverse-phase chromatography (3 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... GAPDH-F (5’-GGA GCGAGATCCCTCCAAAAT-3’) and GAPDH-R (5’-GGCTGTTGTCATACTTCTCATGG-3’) using Power SYBR Green PCR Master Mix (Applied Biosystems). All reactions were carried out on the StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Genetics 2024Quote: All bacterial strains were grown on Lennox LB Agar (5 g/L NaCl, 10 g/L SELECT Peptone 140, 5 g/L SELECT Yeast Extract) (Invitrogen, 12780029) at 30 °C or 37 °C unless specified otherwise and are listed in Table 3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 40 μl of solubilized protein lysate was stained with 5 μl of 5% G-250 sample additive (Thermo Fisher Scientific). Wells of a Native-PAGE 3–12% Bis-Tris protein gel were washed with the dark blue cathode buffer ...
-
bioRxiv - Microbiology 2024Quote: ... then fixed in 4% PFA and stained with 5 μg/ml DAPI and 5 μg/ml CellMask Deep Red (Invitrogen C10046). Plates were imaged using the Opera Phenix high-content screening system ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µL of sample was loaded on a trap column (PepMap C18, 5 mm x 0.3 mm, 5 µm, 100 Å, Thermo Scientific) followed by elution and separation on the analytical column (PepSep C18 ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptides trapped on a 5 mm PepMap 100 C18 column (300 µm ID, 5 µm particle size; Dionex, Thermo Fisher Scientific) and then analyzed on a 200 mm Alltima C18 home-made column (100 µm ID ...
-
bioRxiv - Molecular Biology 2024Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (Thermo Scientific), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and CYPBΔPSI (forward 5′ CGAACTTGTGTTTGGTGGTGTT-3′ and reverse 5′-GCCTTTTTCAGTCACCGGAACA-3′) primers on a StepOnePlusTM Real-Time PCR System (Applied Biosystems, USA) as previously described (Muthusamy et al ...
-
bioRxiv - Microbiology 2024Quote: ... and test virus RNA was detected with forward (5′-CTATGCTGTATACGGATTCGTCC-3′) reverse (5′-GGTGTCACCACAACAATCCAC) primers using a Power SYBR green RNA-to-Ct 1-step kit (Applied Biosystems) on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... A trap-and-elute method was employed with a C18 PepMap100 trap column (300 µm x 5 mm, 5 µm particle size, Thermo Scientific) and an Acclaim PepMap 100 analytical column (75 µm x 25 cm ...
-
bioRxiv - Biochemistry 2024Quote: All crosslinked peptide-(oligo)nucleotide samples were injected onto a C18 PepMap100-trapping column (0.3 x 5 mm, 5 μm, Thermo Scientific™) connected to an in-house packed C18 analytical column (75 μm x 300 mm ...
-
bioRxiv - Molecular Biology 2024Quote: ... Extracts were thawed and centrifuged twice (4000 g 5 min and 10000 g 10 min) before immunoprecipitation with 5 µL rabbit IgG-conjugated M270 epoxy Dynabeads (Invitrogen, #14311D) for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... was injected at 3 µL/min for 1 min into a trap column (Acclaim Pepmap 100 C18, 5 mm x 0.3 mm, 5 µm, Thermo Fisher Scientific). The peptide separation was performed in a 50 cm long analytical column with a 75 µm inner diameter packed in house with C18 beads (Reprosil C18 ...
-
bioRxiv - Biochemistry 2024Quote: ... The grids were blotted for 5 seconds with a blot force of 5 using a Vitrobot Mark IV (Thermo Fisher Scientific) before vitrification in liquid ethane.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µL of sample was loaded on a trap column (PepMap C18, 5 mm x 0.3 mm, 5 µm, 100 Å, Thermo Scientific) followed by elution and separation on the analytical column (PepSep C18 ...
-
bioRxiv - Plant Biology 2020Quote: ... the sample was loaded on a trap column (C18 PepMap 100, 300 µm x 5 mm, 5 mm particle size, 100 Å pore size; Thermo Scientific) and desalted for 5 min using 0.05 % (v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µg DNA was used per flask (in optiMEM) and 5 hours after transfection replaced by F10-DMEM media (Thermo Fisher Scientific). 48 hours post-transfection cells were washed with PBS and scraped off ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer containing the Sp6 promoter (5’ ATTTAGGTGACACTATAGCCTCTTCAGTTCCTTCTTCCATC-3’).The aqp1a.1 probe was generated from whole extracted cDNA at 30hpf and amplified with the primers (5’-GTCATGAACGAGCTGAAGAGC-3’) and (5’-GGGTCACTTTGAGGACATCTC-3’),incorporated into the pCR-BluntII-TOPO vector (Invitrogen, 45-0245) (containing both the SP6 and T7 promoters) ...