Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was performed on lysates to amplify the genomic region targeted by the sgB with primers forward 5’GGGTGTTGTTCAGCGATGGA and reverse 5’ATAGATCTCATTGTGATCGA using Phusion High-Fidelity DNA polymerase (Thermo Scientific). The amplicons were cloned in pCR-bluntII-TOPO vector (Zero Blunt Topo PCR cloning kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were loaded onto a C18 AcclaimTM PepMapTM trap column (100 Å, 5 μm × 0.3 mm × 5 mm, Thermo Fisher Scientific) and washed for 3 min at 30 μL/min before peptides were eluted onto a C18 AcclaimTM PepMapTM column (100 Å ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) by colony PCR (Vaishnava et al., 2011) using DreamTaq Master Mix (ThermoFisher Scientific) and 0.2μM primers ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... using the oligonucleotides WPRE-F 5’-TGCTTCCCGTATGGCTTTCAT-3’ and WPRE-R 5’-CAGCAAACACAGTGCACACC-3’ as primers and SYBR Select Master Mix (ThermoFisher Scientific). The measurements were performed with a CFX384 instrument (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthetic EMCV RNA variants (Table 5) were dissolved in distilled water and labelled at the 5’ end with Dylight 650 maleimide conjugates (Thermo Scientific) using the 5′ EndTag kit (Vector Labs ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and diluted to 30 pg/μl concentration in 5 mM Tris-HCl (pH 7.5) supplemented with 5 ng/µl carrier herring sperm (Thermo Fisher Scientific). The MSI assay was performed using single-molecule PCR (SM-PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies). The pCS2:runx1 probe was a gift from Leonard Zon ...
-
bioRxiv - Genomics 2020Quote: ... using forward primer (5’-TGATTATCGACATCCCGTCA-3’) and reverse primer (5’-GTCTGGAATCTCATAGGTAG-3’) and run on an ABI 7500 thermocycler (Applied Biosystems). Primer specificity and capture temperature were determined by melt curve analysis ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA in the vicinity of the rs7143400 was amplified by PCR using the following primers 5’-GGTTGGGTGTGAATAGGAAT-3’ and 5’-TGCATGCCTGATTTATTTGG-3’ before digestion with Tsp45I enzyme (Thermo Scientific). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analysis of global levels of 5-mdC and 5-hmdC were performed on a Q exactive mass spectrometer (Thermo Fisher Scientific). It was equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Biochemistry 2021Quote: ... Approximately 1 μg of peptides were desalted on a trap column (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and then separated on an in-house packed column (75 μm i.d ...
-
bioRxiv - Cell Biology 2021Quote: ... and resuspended into 5 mL of warm PBS containing 5 μg mL−1 Hoechst 33342 (Thermo Fisher Scientific, Waltham, MA, USA) to stain live leukocytes.
-
bioRxiv - Microbiology 2020Quote: Experiments to determine the sensitivity of the two RT-qPCR methods and nested PCR were completed using serial dilutions of each transcript (5*103 to 10−1 copies/5 µL) in a previously described RNA storage buffer containing RNA storage solution (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Resulting colonies were screened for plasmid presence by PCR of a portion of the pESC-URA-lpt1 plasmid (Forward primer: 5’-TTGGAAACAGCTCCAAATCC-3’, Reverse primer: 5’ CCCAAAACCTTCTCAAGCAA-3’; ordered from ThermoFisher Oligos) and preserved as glycerol stocks.
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... the Peptides were trapped for 10 min on a precolumn (Acclaim PepMap100, C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and subsequently separated using an analytical column (Easyspray 50 cm column (ES803 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 800 ng of digests were loaded in random order onto a pre-column (C18 PepMap 100, 5 µm, 100 A, 300 µm i.d. x 5 mm length, Thermo Fisher, 160454) at a flow rate of 50 µL/min with solvent C (0.05% TFA in water/acetonitrile 98:2).
-
bioRxiv - Neuroscience 2020Quote: ... then four times in PBS for 5 minutes (5 minutes for each wash) before mounting with Floromount G (Thermo Fisher Scientific). Slices were imaged an Olympus VS120 slide scanning microscope ...
-
bioRxiv - Developmental Biology 2022Quote: ... were retrotranscribed from either 5’-CATGCTGCTGGTGGGTGTGCT-3’ or 5’-CCATAAAGCACCGGTGAGCAGAA-3’ endoglin specific reverse oligonucleotides (500 nM) using RevertAid H minus reverse Transcriptase (Thermo Scientific) 10 U/μl in 1X RevertAid H minus Buffer supplemented with 2 U/μl RNAse OUT (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Embryos were then washed twice for 5 min each in PBS and subsequently incubated with 5 µg/ml Hoechst 33342 (Invitrogen, USA) in PBS for 5 min to stain the nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 x 107, or 5 x 107 PFU/mL (MOI of 5, 50, or 100 respectively) in CO2-independent medium (Gibco Life Technologies) supplemented with 0.1% (w/v ...
-
bioRxiv - Biophysics 2022Quote: ... and SN25 FL (1–206, R59C) or truncation mutant (11–206, R59C) were labeled with 5×molar excess Tetramethylrhodamine-5-maleimide (TMR) (Molecular Probes) in 25 mM HEPES pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptides were loaded onto a μ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 μm i.d.×5 mm, 5 μm) (Thermo Scientific), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tryptic peptide mixtures were injected automatically and loaded at a flow rate of 30 μl/min in 0.1% trifluoroacetic acid in HPLC-grade water onto a nano trap column (300 μm i.d. × 5 mm Pre column, packed with Acclaim PepMap100 C18, 5 μm, 100 Å; Thermo Scientific). After 3 minutes ...
-
bioRxiv - Neuroscience 2021Quote: The successfully reprogrammed hiPSCs were incubated in hypoxic conditions (5% CO2, 5% O2) at 37°C and maintained in StemFlex™ media (Gibco) on 6-well NUNC™ plates (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... using the ZIKV-F2 (5’-CAGCTGGCATCATGAAGAATC-3’) and ZIKV-R1 (5’-CACTTGTCCCATC TTCTTCTCC-3’) primers for African strain detection (ThermoFisher SCIENTIFIC) or the ZIKV-F1 (5’-CAGCTGGCATCATGAAGAACC-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... Acclaim™ PepMap™ 100 C18 LC Column (5 mm x 0.3 mm i.d., 5 μm, 100 Å, Thermo Fisher Scientific) was used as trap column at a flow rate of 25 μL min-1 kept at 45 °C ...
-
bioRxiv - Physiology 2022Quote: ... washed once with cold acetone and then dissolved in Laemmli buffer (Tris 10 mM pH 7.5, EDTA 1 mM [Fluka, Buchs, Switzerland], β-mercaptoethanol 5%, SDS 5%, glycerol 10% [ThermoFisher Scientific]). Sonication and centrifugation were repeated as above to pellet and eliminate possibly remaining cell debris ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Microbiology 2022Quote: Hemolytic activity was assessed by spotting 5 μL of growing cells on Columbia agar plates supplemented with 5% defibrinated horse blood (Thermo Scientific), incubated for 24h at 37°C and analyzed for the presence of a lysis halo around the colony.
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences cutting near genomic loci of MLL3 Y4792 (5’-ACTATGGTCATCGAGTACAT-3’) and MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) were synthesized by Thermo Fisher’s custom in vitro transcription service ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membrane was washed 5 times 5 min in TBS-T prior to visualization with SuperSignal West Pico Chemiluminescent Substrate (Fisher Scientific) using the Azure c600 Gel Imaging System (Azure Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: Bladders of 5 young and 5 aged mice were collected and homogenized in TRIzol™ Reagent (15596026, Thermo Fisher Scientific, USA) to extract total RNA followed by DNase 1 treatment (18068-015 ...
-
bioRxiv - Pathology 2021Quote: ... Each paraffin-embedded tissue was sequentially sectioned at 5 μm thickness into 5 consecutive sections and were mounted on HistoGrip (Invitrogen, US) coated glass slides ...
-
bioRxiv - Plant Biology 2021Quote: The IKU2 promoter was amplified using the primers Prom-IKU2-B4 (5’-ggggacaactttgtatagaaaagttgGGTCTCTCTTGATAACGATTTG-3’) and Prom-IKU2-B1R (5’-ggggactgcttttttgtacaaacttgTGTTCTCTACGTCGGAAGG- 3’) and cloned into pDONR-P4-P1R (Life Technologies). A triple LR Gateway reaction (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR was done on1 uL of cDNA using 10 µM of forward and reverse primers (Fw 5’-AAGATTCTCCTGAGCTGGGTC −3’ and Rv 5’-AGTCACTTTAGGTGGCCTTGG −3’, Life technologies) and 1 U Taq DNA polymerase (10342 ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was extracted from each neural tube (5 samples per condition (EPAS1 and 5’-mispair, respectively)) using the RNAqueous Micro Kit (Ambion, #AM1931). Sequencing was performed using NextSeq 500 (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... or equimolar mix of two human APOBEC3A siRNAs (Silencer 45715 and 45810, respectively, with sense sequences 5’-GACCUACCUGUGCUACGAATT-3’ and 5’-GCAGUAUGCUCCCGAUCAATT-3’, Life Technologies) using Lipofectamine RNAiMAX (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Dried fractions were resuspended in 8 μL 5% ACN + 5% FA and analyzed on an Orbitrap Fusion with in-line Easy Nano-LC 1000 (Thermo Scientific). Fractions were run as 3 h gradients progressing from 3% ACN + 0.125% FA to 100% ACN + 0.125% FA ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequently a copy of chromosome XV was removed by counter-selection against the URA3 gene by replica-plating on SD medium containing 1 mg/mL 5-fluoroorotic acid (5-FOA, ThermoFisher Scientific) from a 100 mg/mL stock in DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... or with a pool of two different USP30 siRNAs (D1: 5’-CAAAUUACCTGCCGCACAA-3’; D3, 5’-ACAGGAUGCUCACGAAUUA-3’, Dharmacon; siUSP30) by using Lipofectamine RNAiMAX (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... and human Oct 4 (For: 5’-CTTGCTGCAGAAGTGGGTGGAGGAA-3’/Rev: 5’-CTGCAGTGTGGGTTTCGGGCA-3’) PCRs were conducted using an ABI 7300 Real Time PCR System (Applied Biosystems). PCR cycling conditions were 95° C for 10 min. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The synthesized cDNA was amplified by EBNA 3C (1F and 1R) primers (5’-GAGAAGGGGAGC GTGTGTTGT-3’, 5’-GCTCGTTTTTGACGTCGGC-3’) by using regular PCR and adding Taq DNA polymerase (ThermoFisher, USA). The components of 25 μL reaction mixture contained 10 μL extracted DNA ...
-
bioRxiv - Immunology 2021Quote: ... against the IAV nucleoprotein (forward: 5’-CAGCCTAATCAGACCAAATG-3’; reverse: 5’-TACCTGCTTCTCAGTTCAAG-3’) were assayed using SYBR Green Master Mix (Applied Biosystems) to confirm viral presence in the maternal lung.
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Genetics 2020Quote: ... mouse cDNA was amplified with primers (F: 5-gtttatgggcctcaacctcatg-3, R: 5-caggcttcactccagctttttgg-3) and then enzyme digested with BsiEI (Thermofisher #FD0894). Genotyping result using this method is shown in Fig ...