Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... N,N-diisopropylethylamine (DIEA) and piperidine were from Acros Organics (Geel, Belgium). O-(6-Chlorobenzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (HCTU ...
-
bioRxiv - Bioengineering 2019Quote: ... N,N-dimethylformamide (DMF) solvent (#D119-4) was purchased from Fisher Scientific. PP 24-well plates (#1185U58 ...
-
bioRxiv - Bioengineering 2024Quote: ... N,N-Dimethylformamide (DMF)) were ACS grade and purchased from Fisher Scientific.
-
bioRxiv - Immunology 2021Quote: ... The extracellular domain of NKp46 was cloned into pcDNA Myc-His 3.1a vector (Invitrogen) or pCMV vector (Addgene plasmid #59314 ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2020Quote: ... Each sample was labeled for 2 h at 22°C with a different TMT-tag obtained from a TMT10plex kit (Thermo Fisher Scientific), and then quenched (0.27% hydroxylamine ...
-
bioRxiv - Immunology 2020Quote: ... were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG, Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: Peptides were reconstituted in 100ul of 100mM triethyl ammonium bicarbonate (TEAB) and labeling performed as previously described (1, 2) using TMTPro isobaric tags (Thermofisher Scientific, A44520). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... The remaining pieces of tissues were further digested at 37°C with shaking at 180 rpm for 45 min in 2% FCS in RPMI (Life Technologies), containing 1 mg/ml collagenase Type 1 (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: HeLa cells (ATCC CCL-2) were incubated in RPMI (Roswell Park Memorial Institute) medium containing 5% FCS (fetal calf serum, Gibco®) in an incubator with 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Serum samples at varying dilutions were incubated for 2 h followed by detection by a goat anti-human Fc-HRP secondary antibody (ThermoFisher Scientific). The plasma concentration of AvFc was calculated by interpolating from a standard curve ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Hamster lungs were homogenized and diluted in Hank’s solution with the addition of 2% FCS and antibiotics (streptomycin sulfate and benzylpenicillin sodium salt, 200 U/ml) (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were resuspended in buffer (PBS/2% FCS/ 1% penicillin/streptomycin) containing a viability dye from the Sytox series (Life Technologies) or DAPI (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... substituted with 10% fetal calf serum (FCS; Capricorn Scientific, Palo Alto, CA, USA) and 2 mM L-glutamine (Invitrogen, Carlsbad, USA), 50 U/ml penicillin/streptomycin (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were transfected with plasmids expressing bRSV N-GFP and P in DMEM supplemented with 2% FCS.16 h post transfection medium was replaced with Leibovitz’s L-15 medium without phenol red (Gibco, ThermoFisher Scientific), and imaged live with a Leica TCS SP8 confocal microscope using a 63× oil immersion objective ...
-
bioRxiv - Immunology 2023Quote: ... in PBS for 10 min prior to addition of the relevant surface marker fluorochrome-conjugated antibodies in FACS buffer (PBS, 2% heat-inactivated FCS) supplemented with Super Bright staining buffer (Thermo Fisher). Following 30 min of incubation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Rspo3-Fc Fusion Protein Conditioned Medium (Immunoprecise, #R001-100ml, 2%)] and mixed with 50 µl Matrigel (Fisher Scientific, #CB-40230C). Human alveolar organoid media was refreshed every 3 days until the end of the experiment ...
-
bioRxiv - Molecular Biology 2021Quote: ... N (Invitrogen #MA5-35943), Flag (Sigma # F3165) ...
-
bioRxiv - Cell Biology 2024Quote: ... N-Hydroxysuccinimide (Invitrogen, A37573) was diluted in 0.2 M sodium bicarbonate to a final concentration of 50 µg/mL and applied to cells at RT for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... Biotinylated Spike or RBD were expressed in 1L of HEK293F cells (Invitrogen) at a density of 1.5 × 106 cells/mL ...
-
bioRxiv - Immunology 2021Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Immunology 2021Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We used the ERCC RNA Spike-In Mix (Thermo Fisher Scientific 4456740) in library preparation ...
-
bioRxiv - Immunology 2022Quote: ... The spike probes were purified with HisPur Ni-NTA Resin (Thermo Fisher) as described in the Protein purification section ...
-
bioRxiv - Genomics 2019Quote: ... We added External RNA Control Consortium (ERCC) spike-in controls (Life Technologies) to one microgram of total RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.15 μL ERCC RNA Spike-In Mix (100.000x diluted) (Thermo Scientific, 4456740), 0.15 μL nuclease-free water (NF H2O ...
-
bioRxiv - Microbiology 2020Quote: ... Spike cDNA was produced from the total RNA using superscript iii (ThermoFisher) with specific RT-primers (CAATTGTGAAGATTCTCATA) ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.4 ng spike-in mix was added into the TRIzol (ThermoFisher, 15596018) cell lysis to eliminate technical errors retained during the steps of biotinylating ...
-
bioRxiv - Neuroscience 2022Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion,Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a 1:4,000,000 dilution of ERCC spike-in transcripts (Life Technologies, #4456740) was added to each sample ...
-
bioRxiv - Immunology 2021Quote: ... NVX-CoV2373 Spike protein was coated on Maxisorp ELISA plate (Thermo Fisher), and then blocked with 5% BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... we included Spike-In Mix 1 (1:1000; Life Technologies, Cat# 4456740), as from the Fluidigm manual ...
-
bioRxiv - Microbiology 2021Quote: ... Commercially available polyclonal IgG anti-Spike protein antibody (Thermo Fisher, MA5-35949) or anti-fd bacteriophage antibody (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion,Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Immunology 2020Quote: ... External RNA controls consortium (ERCC) RNA spike-in mixes (Thermo Fisher, 4456740) were included for quality assurance ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1 μl ERCC RNA Spike-In Mix (107 dilution, #4456740, ThermoFisher). After briefly spinning ...
-
bioRxiv - Genetics 2019Quote: Absolute expression analysis used the ERCC spike-in sequences (Ambion, Life Technologies). The analysis used total read counts (not Informative Read counts ...
-
bioRxiv - Genetics 2019Quote: Absolute expression analysis used the ERCC spike-in sequences (Ambion, Life Technologies). The analysis used total read counts (not Informative Read counts ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... 1 μL of 1:200 ERCC RNA Spike-In Mix (Invitrogen, 4456740) was added to each fraction pool and concentration was measured again ...
-
bioRxiv - Cancer Biology 2021Quote: ... External RNA Controls Consortium (ERCC) ExFoldRNA Spike-in Control Mixes (Invitrogen #4456740) (4 μL/sample ...
-
bioRxiv - Immunology 2020Quote: RBD and spike trimer proteins were purified with HisPur NiNTA resin (ThermoFisher). Prior to purification ...
-
bioRxiv - Genomics 2021Quote: ... Spike-in controls were mixed in (Ambion-ERCC Mix, Cat no. 4456740) and Illumina sequencing libraries were made using the RNA TruSeq Stranded total RNA (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Neuroscience 2023Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Bioengineering 2023Quote: ... an equal amount of ERCC RNA Spike-In Mix (ThermoFisher, Cat #4456740) was added to the total RNA extracted from cell number-normalized H1 samples using the recommended dilution ratio before library preparation ...
-
bioRxiv - Immunology 2022Quote: ... and the Wuhan spike protein was purified using Talon Resin (Thermo Scientific) while the D614G VFLIP spike was purified on a StrepTrap XT column (GE Healthcare) ...
-
bioRxiv - Genomics 2024Quote: ... either a 1% dilution of ERCC RNA Spike-In Mix (4456740, ThermoFisher) or fully concentrated samples were processed into a short-read libraries using the TruSeq Stranded mRNA Sample Prep Kit from Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... The carboxyl groups on the bead surfaces were functionalized with amine-reactive groups via N- ethyl-N’-(3-(dimethylamino)propyl)carbodiimide (EDC) and sulfo-N-hydroxysuccinimide (sulfo-NHS, Thermo Fisher) crosslinking for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... the strips were washed 3 times in PBS-T before incubation in primary antibody (GST Tag Mouse anti-Tag, Clone: 8-326, Invitrogen) for 1 h at room temperature ...
-
Lactic Acid Containing Polymers Produced in Engineered Sinorhizobium meliloti and Pseudomonas putidabioRxiv - Microbiology 2019Quote: ... the gel was used for His-tag staining following the InVision(tm) His-tag In-Gel Stain protocol provided by Invitrogen.