Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for Nicotinic Acetylcholine Receptor alpha 1 mAb 35 Rat Monoclonal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Alexa Fluor 594 donkey anti-rat (Invitrogen); and Alexa Fluor 488 goat anti-rabbit (Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... Goat anti-Rat IgG-AF647 (Invitrogen, A21247) and AF488-goat anti-mouse (A11017 ...
-
bioRxiv - Neuroscience 2024Quote: ... and rat cortical astrocytes (Gibco™, N7745100) were seeded at a density of 100 cells/mm2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Rat Alexa fluor 647 (Thermo Fisher Scientific Cat# A21247 ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey anti-Rat 647 IgG (#A21247, ThermoFisher).
-
bioRxiv - Neuroscience 2024Quote: ... Donkey anti-Rat 488 IgG (#A21208, ThermoFisher), Donkey anti-Rat 555 IgG (#A21434 ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey anti-Rat 555 IgG (#A21434, ThermoFisher), Donkey anti-Rat 647 IgG (#A21247 ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-rat Alexa 488 (Thermo Fisher Scientific Cat# A-11006 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-rat Alexa Fluor 405 (Invitrogen A48268), anti-hamster Alexa Fluor 488 (Invitrogen A21110) ...
-
bioRxiv - Neuroscience 2023Quote: ... and Donkey anti-rat-AF488 (Invitrogen, A21208).
-
bioRxiv - Bioengineering 2023Quote: ... and anti-Rat IgG (Thermo Fisher Scientific) overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat anti-mCherry antibody (M11217, Life Technologies) together with chicken anti-Iba1 and rabbit anti-P2Y12 antibody were applied overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-rat 488 (Thermo Fisher A11006), donkey anti-mouse 647 (Thermo Fisher A31571) ...
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti-rat (AF546, A11081, Invitrogen) antibodies ...
-
bioRxiv - Genetics 2023Quote: ... Alexa fluor 568 anti-Rat (Invitrogen, A11077),.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... then incubated with anti-rat FoxP3 (Invitrogen) for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... don-key anti-rat 488 (Invitrogen A21208).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a Rat bFGF ELISA Kit (Invitrogen, CA), and an AssayMax™ Dihydrotestosterone ELISA Kit (Assaypro ...
-
bioRxiv - Bioengineering 2023Quote: ... collagen (Collagen I, Rat Tail, Gibco A1048301), or laminin (Roche 11243217001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Alexa Fluor 488 anti–rat (A11006; Invitrogen), Alexa Fluor 594 Phalloidin (A12381 ...
-
bioRxiv - Neuroscience 2024Quote: ... Sprague Dawley rat cortical neurons (Gibco, A36511) were plated at a density of 750 cells/mm2 ...
-
bioRxiv - Neuroscience 2024Quote: ... donkey anti-rat Alexa Fluor 488 (Invitrogen), and donkey anti-goat Cy3 (Jackson ImmunoResearch Laboratories).
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-SOX2 (ThermoFisher; 14-9811-82), rabbit anti-OCT4 (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-CD86 (Invitrogen, Waltham, MA, USA), rabbit anti-Iba1(FUJIFILM Wako Chemicals U.S.A ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 555-conjugated goat anti-rat (ThermoFisher, #A21434), and 488-conjugated goat anti-chicken (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... or AlexaFluor568 goat anti-rat (Life Technologies). For western blotting ...
-
bioRxiv - Cell Biology 2024Quote: ... and goat anti-rat IgG (Invitrogen, A11007). These antibodies were diluted 1:500 in 1% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-Sall1 (Invitrogen #14-9729-82). Slides were then washed subsequently in TBST and TBS before being incubated for 1 hour in the dark at RT with the following fluorescent conjugated secondary antibodies ...
-
bioRxiv - Bioengineering 2020Quote: ... the HUVECs’ tight junctions were stained using 5 μg/mL ZO-1 (Zonula Occludens-1) Monoclonal Antibody conjugated with Alexa Fluor 488 (Thermo Fisher Scientific) solution in previously prepared 3% BSA during O/N incubation at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2.5X105 cells were used as controls and incubated in the blocking buffer while 6X105 cells were incubated with anti-BrdU monoclonal antibody (1:100; MOBU-1 clone, B35128, Thermo Fisher Scientific) for 1 hr at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... Slides were blocked for 30 min at room temperature in PBS containing 1% BSA and then incubated with mouse monoclonal anti-V5 antibodies (1:200 dilution, Invitrogen #R960-25) at 25°C for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Brains were then incubated in 1 mL of primary antibody solution in blocking buffer (1:50 monoclonal mouse anti-nc82, Developmental Studies Hybridoma Bank, Iowa City, IA; or 1:500 rabbit anti-GFP, Thermofisher cat# A11122) at room temperature for 3 h in constant rotation ...
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
bioRxiv - Immunology 2023Quote: ... After treating the cells for 15 minutes (min) with Fc Receptor Binding Inhibitor Polyclonal Antibody (ThermoFisher), they were stained for 30 min at 4°C in the dark and washed twice again ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transiently transfected with receptor constructs using LipofectamineTM 2000 transfection system (ThermoFisher, cat# 11668019). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-mouse IgG Alexa546-labeled monoclonal antibody goat anti-mouse IgG Alexa633-labeled monoclonal antibody (ThermoFisher Scientific); DAPI ...
-
bioRxiv - Bioengineering 2020Quote: ... The bound mAb was detected with 100 μl/well of TMB substrate (Life Technologies) for 1 min before the addition of 100 μl of 3% H2SO4 to stop the reaction ...
-
bioRxiv - Bioengineering 2021Quote: ... N-protein specific mAb CR3009 was produced by co-transfecting Expi293F cells (Life Technologies) in suspension growing at 37oC in 8% CO2 atmosphere in FreeStyle 293T medium (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... The mAbs were tested for binding using MaxiSorp 96-well plates (Nalgene Nunc International) coated at 2 μg/ml with wt gp120 or gp120 V region deletion mutants in PBS at 4°C overnight ...
-
bioRxiv - Immunology 2022Quote: ... mAbs were also expressed in-house by transient transfection of Expi293 cells (Gibco, A14527) using the ExpiFectamine 293 Transfection Kit (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse and rabbit mAbs were expressed by transient transfection of ExpiCHO cells (Thermo Fisher) with equal amount of paired heavy and κ-light chain plasmids and purified from the culture supernatant after 12-14 days using Protein A beads columns (Thermo Fisher).
-
bioRxiv - Immunology 2020Quote: ... sections were immunostained with hamster anti-mouse CD11c mAb (clone N418, Thermo Fisher Scientific) and rat anti-mouse CD68 mAb (clone FA-11 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-protein specific mAb CR3009 was produced by co-transfecting Expi293F cells (Life Technologies) in suspension growing at 37oC in 8% CO2 atmosphere in FreeStyle 293T medium (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... TβRII-Fc (124 kDa) and murine mAb 1D11 (150 kDa) (Thermo Fisher, Waltham, MA) were each captured on individual flow cells to 100-140 RU ...