Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 3080 citations for ANKZF1 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: Cells were suspended in growth media and added to dishes with 50 pmol pooled siRNA and RNAiMAX (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: HeLa cells were transfected with control or FGF18 siRNAs (Dharmacon SO-2989166G) using Lipofectamine RNAiMAX (Thermo Fisher 137780). The medium was changed 24 hours after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfection of siRNA and miRNA inhibitors were carried out by using Lipofectamine RNAiMax (Thermo Fisher Scientific, Meerbusch, Germany) in accordance with the manufactureŕs instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were then transfected with 50 nM control and ATF4 SilencerSelect siRNA (ThermoFisher Scientific, Catalog no. s1702) using Lipofectamine RNAi Max transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 × 105 cells were initially transfected with 50 nM siRNA using Lipofectamine RNAiMAX following the manufacturer’s protocol (Invitrogen). After 48h of incubation ...
-
bioRxiv - Microbiology 2023Quote: ... 30 nM of siRNA was transfected into the human macrophages using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Three custom stealth small interfering RNA (siRNA) were used to silence galectin-9 (LGALS9HSS142807, LGALS9HSS142808 and LGALS9HSS142809) (Invitrogen). Equal amounts of the siRNA ON-TARGETplus non-targeting (NT ...
-
bioRxiv - Cancer Biology 2023Quote: IRX4_PEP1 transfected PC3 cells were transiently transfected with 10nM siIRX4_PEP1 siRNA (Invitrogen by Life Technologies, cat no # 1299001) using Lipofectamine® RNAiMAX transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were transfected with 10 nM negative control or E-cadherin siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific) in OptiMEM (Thermo fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transfection of siRNAs was carried out using RNAiMAX according to the manufacturer’s instructions (Invitrogen Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transfection of siRNAs was carried out using RNAiMAX according to the manufacturer’s instructions (Invitrogen Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... then treated with siRNA or scramble control to a final concentration of 20nM with RNAiMax (Invitrogen, Carlsbad, CA). The siRNAs for PDGFD were purchased from Origene (SR312885) ...
-
bioRxiv - Immunology 2023Quote: ... with siRNA delivered at a concentration of either 20 or 50 nM in serum-depleted medium (OptiMEM; Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... cells were harvested 4 days post siRNA transfection using the Power SYBR Green Cells-to-CT kit (Invitrogen). IDT PrimeTime qPCR Primers for MORC3 and SETDB1 were used and expression levels were normalized to 18S ...
-
Deciphering the gene regulatory circuitry governing chemoresistance in Triple-Negative Breast CancerbioRxiv - Cancer Biology 2023Quote: ... siRNA at a final concentration of 5 pmol was diluted in 45 μL of Opti-MEM (Gibco, 31985047) and 2.25 μl of Lipofectamine RNAiMAX was diluted in 45 μl of OPTI-MEM ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were transfected with 15 nM siRNA (AP2M1: Thermo Fisher Scientific # 1299001, HSS101955; SCR: Thermo Fisher Scientific #12935300) with 3.33 µL Lipofectamine RNAiMax (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... The siRNAs used for silencing target candidate proteins were purchased from Silencer Select (Ambion, Life Technologies, CA, USA) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small interfering RNAs (siRNAs) (Table S5) were transfected into cells using Lipofectamine RNAiMAX reagent (13778-075, Thermo Fisher) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... Three custom stealth small interfering RNA (siRNA) were used to silence galectin-9 (LGALS9HSS142807, LGALS9HSS142808 and LGALS9HSS142809) (Invitrogen). Equal amounts of the siRNA ON-TARGETplus non-targeting (NT ...
-
bioRxiv - Genomics 2023Quote: Knockdown of ERG was performed as previously described (40) using 1 nM siRNA oligonucleotides in OptiMEM (ThermoFisher Scientific) with Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... VSMC grown at 70% confluence were transfected overnight with 30 nM siRNA using lipofectamin RNAiMax (Invitrogen, 13778-075). After washing ...
-
bioRxiv - Genomics 2024Quote: MEFs were transfected with 200 nM FAK or p130Cas siRNAs using Lipofectamine 2000 reagent (cat. no. 11668019, Invitrogen) in Opti-MEM (cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs for ALKBH5 (1; s29686 and #2; s29688) and non-targeting control (4390844) were obtained from Thermo Fisher Scientific and transfected using DharmaFECT 4 Transfection Reagent (Horizon Discovery ...
-
bioRxiv - Cancer Biology 2023Quote: EIF4A3 expression was silenced in the cell lines using specific predesigned small interference RNAs (siRNA; #138378, ThermoFisher Scientific). A Negative Control siRNA was also used (#4390843 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell lines were transfected using a mix of 30 nM concentration of siRNA and RNAiMax lipofectamine (ThermoFisher Scientific), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were seeded in 6-well plates directly with the siRNA/transfection mix: 3µl of LipoRNAiMax (Life Technologies), 500µL of OptiMEM (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equivalent quantities of siESR1 or scramble siRNA (scRNA) were forward transfected following the Lipofectamine RNAiMAX (ThermoFisher Scientific #13778150) protocol according to manufacturer’s instructions.
-
bioRxiv - Systems Biology 2023Quote: ... Cells were transfected with siRNA oligomer (final concentration 50 nM) mixed with Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific) in serum-reduced Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were first reverse transfected with siRNAs at a final concentration of 10 nM using Lipofectamine RNAiMAX (Invitrogen) and seeded in 96-well glass-botom imaging plates ...
-
bioRxiv - Biochemistry 2023Quote: ... or untargeted control siRNA (Dharmacon) using DharmaFECT 4 Transfection Reagent in Opti-MEM media (Life Technologies, Carlsbad, CA), according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA transfection was performed at a final concentration of 10 nM using Lipofectamine RNAiMAX transfection reagent (Invitrogen, 13778500) and Opti-MEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLaK and Hek293T cells were transfected with with 50-100 nmol siRNA duplex (Eurofins Genomics) using RNAiMax (Invitrogen) or a calcium phosphate-based method ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA knockdown was carried out following the protocol from Lipofectamine™ RNAiMAX transfection (Invitrogen, catalog no. 13778-100). Cells were harvested 48 hours post transfection and using the protocol as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... The expression of genes of interest was silenced in HeLa cells using Stealth RNAi siRNA (Thermo Fisher Scientific) in Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: Small interfering RNA (siRNA) targeting NFIX and negative control oligonucleotides were purchased from Invitrogen (#1299003, Carlsbad, CA, USA). Three independent NFIX-specific siRNAs were used in this study ...
-
bioRxiv - Molecular Biology 2024Quote: RNA interference (25nM for siRAD51, 60nM for the rest siRNAs) was achieved with Lipofectamine RNAiMax (Life technologies, 13778075) in OPTI-MEM (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... Block-iT Alexa Fluor Red Fluorescent Control siRNA was used as non-targeting negative control (Life Technologies, #14750100). Cells were grown in 60 mm cell culture dishes in medium supplemented with 2% FBS overnight and transfected with 62.5 pmol of the indicated siRNAs applying Lipofectamine RNAiMAX (Invitrogen ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... cells were treated with three different commercially validated AREG targeting siRNA (Ambion, see oligo sequences on Table S5), a negative control siRNA (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Gene silencing of ALIX was performed in mCCD cells using siRNA and Lipofectamine® 3000 (Thermo Fisher Scientific). mCCD WT cells were seeded in DMEM/F12 in 6-well plates at 70-80% confluency ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with 6 nM siRNA mixed with OptiMEM reduced serum medium (Thermo Fisher Scientific, Cat# 31985062) using Lipofectamine RNAiMAX transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells-were transfected in 6-cm plates 24 hours after second siRNA transfection with Lipofectamine 2000 (ThermoFisher Scientific) and 2 μg of pCMV6M-Pak1-WT (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 72 h after siRNA depletion cells were lysed directly in 1x LDS sample buffer (cat#: NP0007, Thermo Fisher) with β-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection mixes were prepared using 0.25 nM siRNA and 2.5 μL Lipofectamine RNAiMAX Transfection Reagent (Cat# 13778075, Life Technologies) to a total volume of 500 μL transfection mixture in Opti-MEM Reduced Serum Media (Cat# 31985-062 ...
-
bioRxiv - Cancer Biology 2021Quote: 4×105 cells were reverse transfected with 25 pmol siRNA using Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher Scientific, 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Transfections of NIH-3T3 cells with siRNA targeting mouse Tmed2 (Fwd: CACCUCUAAUUGAAUUGAACAAGCA, Rev: UGCUUGUUCAAUUCAAUUAGAGGUGAU) were performed with RNAiMax (Invitrogen). The Negative Control DsiRNA (IDT ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated with 40 nM siRNA and 4μL for CPT1A KD and 5 μL for DRP1 KD RNAiMAX in OptiMEM (Gibco) for 4–5 hours ...
-
bioRxiv - Cell Biology 2020Quote: Near-confluent (80-90%) MEFs were transfected with 150 nM lamellipodin or Rac1 siRNAs using Lipofectamine 2000 reagent (Invitrogen) in reduced serum Opti-MEM as previously described [1 ...
-
bioRxiv - Molecular Biology 2021Quote: For siRNA transfection experiments: HEK293 cells were grown in 6-well plates and RNAimax transfection reagent (Invitrogen #13778-150) was used following the manufacturer’s protocol ...