Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 3080 citations for ANKZF1 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2×104 iBMDMs (6-well plates) were transfected in suspension with 20 nM siRNA using Lipofectamine RNAiMAX (Invitrogen) in 200 μ Opti-MEM I (ThermoFisher).AllStars negative-control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... were plated in 12 well plate and final 50 nM siRNAs were reverse-transfected using Lipofectamine RNAiMAX (Invitrogen) and ON-TARGETplus SMARTpool siRNAs (Horizon Discovery) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and control siRNA (IDT) were transfected into the Bear cell line using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA) by following the manufacturer’s recommendations (Supplementary Tables 1 and 3) ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T and HeLa cells were transfected with a final concentration of 20 nM siRNAs using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... A standard protocol for transfection was used combining 3.3 µl of 30 µM siRNA with 1.5 µl of Lipofectamine 2000 (Invitrogen). Cells were examined by light microscopy 48 hours post-transfection.
-
bioRxiv - Biochemistry 2022Quote: The transfection of siRNA was achieved with the use of Lipofectamine RNAiMAX (Thermo Fisher Scientific, catalog number 13778075) with a final concentration of 50 nM siRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected with 25 nM siRNA using Lipofectamine 3000 without p3000 reagent according to manufacturer instructions (ThermoFisher). Following 48 to 72h post-transfection ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells (1.0 × 106) were transfected with human siRNA (10 nM) using Lipofectamine 3000 (Invitrogen, Waltham, MA). All siRNAs were ON-TARGETplus SMARTpool (Dharmacon ...
-
bioRxiv - Molecular Biology 2021Quote: Transfection of small interfering RNA (siRNA) was carried out using Lipofectamine RNAiMAX according to the manufacturer’s instructions (Invitrogen). For siRNA transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA/miRNA transfection for all cell lines was conducted with Lipofectamine RNAiMAX reagent following the manufacturer’s instructions (Invitrogen) and using a ratio 10pmol:2μL RNA:Lipofectamine RNAiMAX ...
-
bioRxiv - Biochemistry 2020Quote: U2AF2 levels were reduced by transfection of HEK 293T cells with Stealth™ siRNA HSS117616 (Thermo Fisher Sci.) and compared to a “lo GC” negative control Stealth™ siRNA using JetPrimeR Polyplus-transfection as instructed by the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... VHS40789) and a nonspecific control siRNA duplex with similar GC content (siCtrl; Medium GC Duplex #2) from Invitrogen. siRNAs against MCM5 were designed according to a previous report (Ge et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA interference was performed using a commercial siRNA for TBX1 or VEGFR3 (ON-TARGETplus SMARTpool, Thermo Fisher Scientific) (40 nM ...
-
bioRxiv - Cell Biology 2022Quote: Co-transfection of SPLICSNU-MT plasmids and siRNAs for HOIP silencing was performed using Lipofectamine 3000 (Thermo Fisher). 400,000 HeLa cells/well were seeded on a 6-well plate in the evening ...
-
bioRxiv - Genomics 2019Quote: ... ESCs were cultured in M15 medium and transfected with 50 nM siRNA using Lipofectamine 2000 (Thermo Fisher, 11668019) at day 0 and collected after 48 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control (Cat#D-001810) and SMURF2 (Cat#D-007194) small interfering RNA (siRNA) were purchased from Thermo Fisher Scientific (Lafayette ...
-
bioRxiv - Immunology 2019Quote: ... M-MØ (1 × 106 cells) were transfected with AhR-specific siRNA (siAhR) (50 nM) (# s1199, Thermo-Fisher Scientific), using HiPerFect (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: All cells were transfected with siRNAs for a 20 nM final concentration using Lipofectamine RNAimax (Invitrogen™, 13778030) when plated ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with 50 nM non-target or ATP6V0C or tetherin siRNA with Oligofectamine transfection reagent (Invitrogen) in serum-free DMEM ...
-
bioRxiv - Cancer Biology 2019Quote: ... according to the manufacturer’s instructions using following siRNAs: siControl (Silencer Select Negative Control No. 1, Thermo Fisher Scientific), siNRF2 #1 (n290469 ...
-
bioRxiv - Cell Biology 2019Quote: HMVEC-Cs were transfected with siRNA using Opti-MEMTM I Reduced Serum Medium (31985070, ThermoFisher Scientific, Waltham, MA) and Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2019Quote: ... NRCMs were transfected with small interfering RNA (siRNA) specific for programmed cell death 4 (PDCD4) (Thermo Fisher Scientific), 10-nM mirVana hsa-miR-21 specific inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA knockdown of AC1 and AC9 expression in HEK293 cells was carried out using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNAs were transfected into NSC-34 or N2A cells using Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific, 13778-075) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Cells were transfected with siRNAs synthesized by Integrated DNA Technologies (IDT) using RNAiMax Transfection reagents (Thermo Fisher Scientific) recommended by the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: 293T cells were transfected with 10 nM of each siRNA using the lipofectamine RNAiMAX transfection reagent (ThermoFisher Scientific), according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with siRNA by combining 10µl of 20µM siRNA and 5µL Dharmafect (Dharmacon, T-2001-03) in 800µL OptiMEM (Gibco, 31985-062) and adding to a 6-well plate in RPMI media to a total volume of 4mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... primary CM and H9c2 cells were transfected with short interfering RNA (siRNA) at 10nM using Lipofectamine RNAimax (Invitrogen) 24h and 48h after plating and analyzed at 96h ...
-
bioRxiv - Molecular Biology 2021Quote: ... HepG2 and Huh-7 cells were transfected with miRNA or siRNA using LipofectamineTM RNAiMAX transfection reagent (ThermoFisher Scientific) according to the manufacturer’s instructions and following experiments were performed 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: The expression of proteins of interest was suppressed using 83 nM siRNA and lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... siRNAs (3μl of 10μM conc.) and RNAiMax (7 μl) were mixed separately with 75 μl Optimem (Thermofisher, 31985062). Knockdown was initiated by mixing both siRNA and RNAiMAX suspensions together ...
-
bioRxiv - Microbiology 2022Quote: iSLK.219 cells were transfected while in suspension (reverse transfection) with 10 nM siRNAs (purchased from Thermo Fisher) against STING (HSS139156) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transient transfection was performed using 30 nmol/L siRNA or 25 nmol/ L ASO and Lipofectamine RNAiMAX (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... siRNA transfection was performed at a final concentration of 10 nM using Lipofectamine RNAiMAX transfection reagent (Invitrogen, 13778500) and Opti-MEM (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... HK2 cells were plated in 24well-plate and then transfected with siRNA using Lipofectamine RNAiMax (Thermo Fisher Scientific). For each well to be transfected ...
-
bioRxiv - Cell Biology 2022Quote: ... or the scrambled negative control siRNA was used at a final concentration of 20 nM (Thermo Fisher, AM4611), and were transfected into cells using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: RNAi experiments were performed according to manufacturer’s instructions with 25 nM double stranded siRNA and Lipofectamine RNAiMax (Invitrogen). Depending on the experiments the cells were harvest after 48 to 96 h after RNAi ...
-
bioRxiv - Microbiology 2022Quote: ... Cytotoxicity of siRNA treatment was determined by replacing cell media with a 1:10 dilution of alamarBlue (ThermoFisher) in appropriate cell culture media and incubating for 1-2 hrs ...
-
bioRxiv - Microbiology 2022Quote: ... left over-night for adherence and then transfected with the siRNAs (50 nM) using the Lipofectamine RNAiMAX (Invitrogen) transfection reagent ...
-
bioRxiv - Microbiology 2022Quote: ... 60 pmol of siRNA were mixed with 1.5 μl Lipo3000 in 50 μl of OPTIMEM (Gibco Life Technologies) without serum for 15 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 60 pmol of siRNA were mixed with 1.5 μl Lipo3000 in 50 μl of OPTIMEM (Gibco Life Technologies) without serum for 15 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... U2OS cells were transfected with a mixture of three Stealth™ siRNA duplex oligonucleotides (Invitrogen; HSS123763, HSS123765, HSS182809) at a concentration of 10 nM each ...
-
bioRxiv - Cell Biology 2022Quote: Two separate human ASAH1-siRNAs (50 nM) (Dharmacon,) were transfected into 621-101 cells using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: ... Ten microliters of 20 μM siRNA was introduced into BMMCs (5 × 106) by a Neon Transfection System (Invitrogen) set at Program #5 using a Neon 100 μL Kit.
-
bioRxiv - Molecular Biology 2023Quote: ... The siRNAs used for silencing target candidate proteins were purchased from Silencer Select (Ambion, Life Technologies, CA, USA) (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfection of siRNA at a final concentration of 20 nM was performed using Lipofectamine 3000 (Invitrogen, CA, USA) according to the protocol recommended by the manufacturer.
-
bioRxiv - Microbiology 2022Quote: SK-N-SH cells were first transfected with 20 nM of siRNA against TSG101 using Lipofectamine RNAiMAX (Invitrogen). At 48 h post-transfection of siRNA ...
-
bioRxiv - Cancer Biology 2023Quote: IRX4_PEP1 transfected PC3 cells were transiently transfected with 10nM siIRX4_PEP1 siRNA (Invitrogen by Life Technologies, cat no # 1299001) using Lipofectamine® RNAiMAX transfection Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 × 105 cells were initially transfected with 50 nM siRNA using Lipofectamine RNAiMAX following the manufacturer’s protocol (Invitrogen). After 48h of incubation ...