Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... or using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Fisher Scientific, AC158992500, Waltham, MA, USA) at 570 nm ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Pathology 2023Quote: Tail and ear fragments from mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Cancer Biology 2023Quote: Cell proliferation was assayed by reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, M6494). MTT was freshly dissolved into PBS at a stock concentration of 12 mM and diluted into phenol red-free DMEM with 10% FBS for a final MTT concentration of 2 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-rabbit Alexa 647 (Invitrogen, Waltham, MA; for N = 3 birds). After 3 more washes in 0.1 % PBT ...
-
bioRxiv - Pathology 2022Quote: ... VSMCs (n = 3) were lysed using Pierce immunoprecipitation lysis buffer (Thermo Scientific, 87788) supplemented with protease inhibitor ...
-
bioRxiv - Microbiology 2020Quote: ... containing 2% heat-inactivated autologous plasma and 2 mM L-glutamine (Life Technologies), unless otherwise stated ...
-
bioRxiv - Biophysics 2020Quote: ... and stimulated with 50 U/mL recombinant interleukin-2 (IL-2, Thermo Fisher) and 5 μg/mL phytohaemagglutinin (PHA ...
-
bioRxiv - Neuroscience 2022Quote: ... GlutaMAX and FGF-2 (2 ng/ml) (all reagents from Thermo Fisher Scientific) in 24-well plates for 2 weeks on coverslips coated with poly-D-lysine (100 µg/ml) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 min) to nitrocellulose membranes using an iBlot 2 Dry Blotting System (Invitrogen). Membranes were briefly washed in PBS-T (0.1% Tween-20/PBS) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... at 2 mA cm−2 in a semi-dry electroblotter (Thermo Fisher Scientific) for 45 min using 1 × TBE buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and 30 U/ml of interleukin-2 (IL-2; Thermo Fisher Scientific, PHC0026) at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... EBM-2/EGM-2 medium was supplemented with puromycin (1 mg/ml, Gibco) for 3 d ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 ELISA was performed using IL-2 Mouse Uncoated ELISA Kit (Invitrogen) following manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... 2 h goat anti-rabbit IgG F(ab’)2-AF488 secondary antibody (Invitrogen), 15 min DAPI (1:1000) ...
-
bioRxiv - Neuroscience 2024Quote: ... they were loaded with 2 µM Fura-2-AM (Invitrogen/Thermo Fisher Scientific) dissolved in normal Ca2+-buffer (150 mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... they were loaded with 2 µM Fura-2-AM (Invitrogen/Thermo Fisher Scientific) dissolved in normal Ca2+-buffer (150 mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 150uL of Tyrode’s containing 2 uM Fura 2-AM (Invitrogen F1221, Lot 2559176)/ Pluronic F-127 (Invitrogen P3000MP ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 µL Invitrogen TURBO DNase and 2 µL SUPERase•In RNase Inhibitor (Invitrogen). After digest ...
-
bioRxiv - Microbiology 2023Quote: ... for adipose fat or 2 mg/mL collagenase type 2 (ThermoFisher Scientific, 17101015) for lung samples ...
-
bioRxiv - Immunology 2023Quote: ... 5x10-5 M 2-mercaptoethanol (2-ME) and 5 mM HEPES (all Invitrogen).
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated with 2 μM Fura-2 AM (Thermo Fisher Scientific, F1225) for 30 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Myocytes were then loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously (Batiste et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mM glutamine and 2 mM HEPES (Thermo Fisher Scientific, Waltham, MA, USA). Cell culture medium was supplemented with 1.5 μg mL−1 recombinant ApoE (Sigma) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10% glycerol (2 mM 2-mercaptoethanol (BME) and protease inhibitor tablet (ThermoFisher Scientific) added immediately before use) ...
-
bioRxiv - Neuroscience 2019Quote: Plated DRG cultures were loaded with fura-2 by 1-hour incubation with a mixture of 2 μM fura-2 AM (Thermo Fisher Scientific) and 0.01% pluronic acid (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... and for bank vole cells NBM complete was switched to DMEM complete supplemented with 1% N-2 supplement (Gibco™ Thermo Fisher, USA). Mouse or bank vole glia cells were plated at 1×105 or 5×104 cells/well ...
-
bioRxiv - Neuroscience 2021Quote: ... and for bank vole cells NBM complete was switched to DMEM complete supplemented with 1% N-2 supplement (Gibco™ Thermo Fisher, USA). Mouse or bank vole glia cells were plated at 1×105 or 5×104 cells/well ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were targeted in a second bioreactor sampling experiment (n=2 for both bioreactors) for which the Plasmid Miniprep kit was used according to manufacturer’s instruction (Thermo Fisher Scientific, Waltham, US), with the addition of a step homogenizing the cells before processing ...
-
bioRxiv - Microbiology 2021Quote: ... Four microliters RNA was used for real-time RT-qPCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) as described [41] using the following primers and probes ...
-
bioRxiv - Neuroscience 2024Quote: ... Neuronal differentiation was induced by culturing NGN2-NPC in neural differentiation medium (DMEM/F-12 + Glutamax, Gibco®; 1x N-2 supplement, Gibco®; 1x B27 supplement without vitamin A, Gibco®) supplemented with doxycycline (2µg/ml) ...
-
bioRxiv - Immunology 2023Quote: Open-reading frames coding for either Nefmut alone or fused with SARS-CoV-2 N protein were cloned into pVAX1 plasmid (Thermo Fisher, Waltham, MA) as previously described [20] ...
-
bioRxiv - Microbiology 2023Quote: ... Four microliters RNA was used for real-time RT-qPCR to detect and quantify N gene of SARS- CoV-2 using TaqMan™ RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) as described (73 ...
-
bioRxiv - Immunology 2023Quote: ... The peptides were separated at a flow rate of 300 nL/min on C18 pre-column (Acclaim PepMap™ 100, 75 µm × 2 cm, nanoViper, P/N 164946, ThermoFisher Scientific Incorporation) followed by analytical column (Acclaim PepMap™ RSLC C18 ...
-
bioRxiv - Genomics 2023Quote: ... Cells were then plated onto Geltrex-coated surfaces at 1.5×105 cells/cm2 in the induction medium (DMEM/F12 supplemented with 1× N-2 (Thermo Fisher Scientific, cat# 17502048), 1× non-essential amino acids (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The peptides were separated at a flow rate of 300 nL/minute on C18 pre-column (Acclaim PepMap™ 100, 75 μm□×□2 cm, nanoViper, P/N 164946, ThermoFisher Scientific Incorporation) followed by analytical column (Acclaim PepMap™ RSLC C18 ...