Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for 6 Bromo 3 N ethylamino 1 2 4 triazolo 4 3 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from HTM cells ± DEX at 7 d (N = 3 per group and donor) using PureLink RNA Mini Kit (Invitrogen). RNA concentration was determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from hiPSC-derived cortical neurons at DIV8 (Q5, Q6, n=3 each group) using the miRVana miRNA isolation kit (#AM1560, Ambion, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from dissected hippocampal brain tissue (n = 3 females/genotype and age) preserved in RNAlater (AM7020, Thermo Scientific) using RNeasy Lipid Tissue Mini Kit (74804 ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Neuroscience 2024Quote: ... Brains were then washed in PBST-2 (PBS containing 0.1% Triton X-100) for 3 × 2 minutes and blocked with SeaBlock blocking buffer (ThermoFisher) for 15 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Dissected retinas were either fixed in 4% formaldehyde (MilliporeSigma, Cat.# FX0415-4) in PBS for 2 hours at room temperature or lysed with RIPA buffer (Thermo Fisher Scientific, Cat.# 89900) containing protease and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of 4 mM resazurin sodium salt (Acros Organics, Belgium), 0.002 U purified Castellaniella defragrans geraniol dehydrogenase ...
-
bioRxiv - Biophysics 2019Quote: Isolated islets were loaded with 4 µM Fluo-4 AM (Invitrogen) for 45min at 37°C in imaging medium (125mM NaCl ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... isolated with Protein A Dynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 3:1 ratio with 1X penicillin/streptomycin (Gibco; 15070) and 5% FBS (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... in Fibroblast medium (3:1 DMEM: Ham’s F12 Nutrient Mixture, Gibco) supplemented with 10% FCS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sections were counterstained with ToPro-3 (1:1000 dilution; Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... and washed 3 times with 1x PBS (Fisher Scientific, BP399-1).
-
bioRxiv - Microbiology 2020Quote: ... and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000 dilution, Invitrogen). Secondary antibodies against rabbit and mouse IgG conjugated to IRDye 680LT or IRDye 800CW were obtained from Li-Cor (1:10,000 dilution) ...
-
bioRxiv - Cancer Biology 2022Quote: ... BxPC-3 and PSN-1 were cultured in RPMI1640 (Thermo Fisher), supplemented with 10% FCS and 1% P/S ...
-
bioRxiv - Microbiology 2022Quote: ... 1 nM TO-PRO™-3 Iodide (642/661 nm, Thermofisher) and 8 ng/ml calcofluor-white (CW ...
-
bioRxiv - Microbiology 2022Quote: ... 1 nM TO-PRO™-3 Iodide (642/661 nm, Thermofisher) and 8 ng/ml calcofluor-white (CW ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nuclei were labeled using TOPRO-3 (1:1000, T3605, Life Technologies). Brains were mounted for confocal microscopy in Vectashield (Vector Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were collected into FAD media (DMEM/F12 3:1 (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2019Quote: ... 1 cm pieces and washed 3 times with 1x HBSS (Gibco) containing 15 mM HEPES (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... for RPE1] in 1:3 ratio in Opti-MEM media (Gibco), incubated for 15 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were transfected at DIV 1-3 using Lipofectamine 2000 (Invitrogen). For one Ø18-mm coverslip seeded with 100,000 neurons ...
-
bioRxiv - Immunology 2021Quote: ... and goat anti-mouse Cyanine 3 (Life technologies, A10521, 1:1000). Images for BrdU staining were taken using a Zeiss Confocal (LSM710 META) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μl of DNA ladder (1 Kb Plus DNA Ladder; Invitrogen), 6 μl of positive control and 10μl of template DNA were ran on 2.5% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μM FluoZin-3 tetrapotassium salt (Thermo Fisher Scientific, Waltham, MA) was then added to each reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... Incubation with TO-PRO-3 (1:100, ThermoFisher Scientific Ref. T3605) was performed along with secondary antibody incubation to stain nucleic acid ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was labeled with ToPro-3 (1:5000; Invitrogen, Cat #T3605) in 0.3% PBST for 30 min at RT ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 3 µg ml-1 of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...
-
bioRxiv - Genomics 2022Quote: ... at a 1:3 ratio in Opti-MEM medium (Gibco, 11524456), incubated for 15 minutes at room temperature and added dropwise to the cells ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-14-3-3γ 1:2000 (Thermo fisher PA5-29690) and mouse anti-GAPDH (CSB-MA000195 ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Physiology 2023Quote: ... counterstained with 1:30,000 TO-PRO-3 Iodide (Life Technologies, T3605), and then mounted in SlowFade Diamond mounting medium (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Cy-3 conjugated anti-rabbit secondary antibody (Invitrogen, 1:300 dilution) was added and incubated for 0.5 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were immersed in 3 µM FM 1-43FX (ThermoFisher, F25255) in E3 for 30 s ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were run on 6% TBE gel in 1 x TBE (150 V, 90 min, 4°C) stained with SYBR Gold (Thermo Fisher Scientific. S11494) and InstantBlue Protein Stain (Expedeon).
-
bioRxiv - Cell Biology 2024Quote: ... and 1 µg/mL fibronectin in DMEM F12 with 1 % N-2 supplement (Invitrogen #17502048), 1 % L-Glutamine (Biological Industries #03-020-1B) ...
-
bioRxiv - Biophysics 2022Quote: ... Purified Syb2 (29–96, S61C) was labeled with 6× molar excess BODIPY FL N-(2-aminoethyl)-maleimide (BDPY) (Molecular Probes) and SN25 FL (1–206 ...