Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Immunology 2023Quote: ... and activated with a mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 100 mM N-hydroxysuccinimide (Thermo Fisher Scientific). The activated chip was lawned with goat anti-human IgG Fc (50 µg/mL ...
-
bioRxiv - Immunology 2023Quote: ... and activated with a mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 100 mM N-hydroxysuccinimide (Thermo Fisher Scientific). The activated chip was coupled directly to mAbs diluted to 10 µg/mL in 10 mM sodium acetate (pH 4.5 ...
-
bioRxiv - Microbiology 2023Quote: ... The chip was activated with a freshly prepared solution of 130 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Pierce PG82079) and 33 mM N-hydroxysulfosuccinimide (Sulfo-NHS) (ThermoFisher Scientific 24510) in 0.1 M MES pH 5.5 using the SFC ...
-
bioRxiv - Microbiology 2023Quote: ... The chip was activated with a freshly prepared solution of 130 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Pierce PG82079) and 33 mM N-hydroxysulfosuccinimide (Sulfo-NHS) (ThermoFisher Scientific 24510) in 0.1 M MES pH 5.5 using the SFC ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were live-dead stained with 2 µM calcein acetoxymethyl and 4 µM ethidium homodimer-1 (#L3224, Thermo Fisher) and imaged using fluorescent microscopy to compare cell density and viability between each silicone substrate ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 µg PAX2 and 4 µg shRNA in pLKO.1 backbone using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... thinly sliced (1-2 mm) tissue samples were fixed overnight at 4°C in neutral-buffered formalin (Fisher Scientific) with PhosSTOP added (Roche) ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microliter of sample was diluted in 9 ul Hi-Di™ Formamide (Applied Biosystems) containing 0.25 ul GeneScan™ 600 LIZ™ Size Standard ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Biochemistry 2020Quote: Cultured DRG neurons were loaded with 4 μM Fura-2 AM (Life Technologies) in culture medium at 37°C for at least 60 minutes before use ...
-
bioRxiv - Cell Biology 2021Quote: LX-2 and TWNT-4 human HSCs were lysed in TRIzol (Life Technologies) and total RNA was purified following the supplied protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 mL of 2 mM disuccinimidyl glutarate (DSG,Life Technologies, #20593, Carlsbad, CA) prepared in 1X PBS was added per 1 × 107 cells to the conical tube and the solution was mixed thoroughly by pipetting to remove clumps ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM MgCl2) and 4 μM of the phosphobinding protein (PBP) (Life Technologies) to detect the inorganic phosphate (Pi ...
-
bioRxiv - Immunology 2020Quote: ... P2X7a 451L or P2X7a 451P were loaded with 2 μM Fluo-4 (Invitrogen) for 20 min at 4°C and 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... XEN cells were passaged every 2–4 days using TrypLE Express (Thermo Fisher) up to passage 20.
-
bioRxiv - Microbiology 2023Quote: ... A pCR 4-TOPO or pCR- XL-2-TOPO plasmid (ThermoFisher, Waltham, Massachusetts) with an insert spanning ITS1-5.8S rRNA-ITS2-D1/D2 region of 28S rRNA from a pure culture strain was used as a positive control ...
-
bioRxiv - Physiology 2023Quote: Freshly isolated cardiomyocytes were loaded with 2 μM Fluo-4-AM (Thermo Fisher) for 20 min at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and an additional 2 mM L-glutamine (Gibco; 4 mM total L-glutamine). Cells and parasites were incubated at 37°C and 5% CO2 in a humidified incubator ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cyclopentylidene-[4-(4ʹ-chlorophenyl)thiazol-2-yl]hydrazone (CPTH2) was purchased from ThermoFisher Scientific and used at a 50µM concentration ...
-
bioRxiv - Microbiology 2024Quote: ... then fixed with 2% paraformaldehyde (pH = 7.2-7.4, Fisher Scientific 30525-89-4) for 15m ...
-
bioRxiv - Developmental Biology 2020Quote: Transfection mix was prepared by combining PEI and plasmid DNA (4:1 ratio; 4 µg PEI per 1 µg DNA) in Opti-MEM™ Reduced Serum Medium (Thermo Fisher Scientific) followed by brief vortexing ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 isolate Wuhan-Hu-1 (GenBank accession #: MN908947) at a 4:1 ratio by lipofectamine 3000 (Thermo Fisher Scientific). After 48 to 72 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were passaged 1:4 into new six-well plates with complete DMEM containing 2 μg mL-1 puromycin (Thermo Fisher Scientific). After selection for two weeks ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Bioengineering 2022Quote: ... lungs were rinsed with antibiotics/antimycotics (10% P/S, 4% amphotericin-B [Sigma], 0.4% gentamicin [Gemini Bio] in PBS with Ca2+ and Mg2+ [Gibco]) followed by perfusion with 0.0035% Triton X-100 (American Bioanalytical) ...
-
bioRxiv - Immunology 2023Quote: ... Raji B cells were labelled in serum-free medium with 10 μM 7-amino-4-chloromethylcoumarin (CMAC, Thermofisher, USA) for 1 hour at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... frozen at -20°C and resuspended in 4 mL/gr of pellet of B-PER Reagent (Thermo Fisher Scientific) with 2 µl of lysozyme (50 mg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... Brains were then washed in PBST-2 (PBS containing 0.1% Triton X-100) for 3 × 2 minutes and blocked with SeaBlock blocking buffer (ThermoFisher) for 15 minutes at room temperature ...
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Bioengineering 2022Quote: The DNA origami was folded in a one-pot reaction by gradually decreasing the temperature using a Proflex 3×32-well PCR system (ThermoFisher). The scaffold strands (p7249 and p7560 variants of single-stranded M13mp18 ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ probes FAM-ACCCCGCATTACGTTTGGTGGACC-QSY 3’) and Quantitative Superscript III Platinum One-step RT-qPCR systems with the ROX kit (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... Dissected retinas were either fixed in 4% formaldehyde (MilliporeSigma, Cat.# FX0415-4) in PBS for 2 hours at room temperature or lysed with RIPA buffer (Thermo Fisher Scientific, Cat.# 89900) containing protease and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of 4 mM resazurin sodium salt (Acros Organics, Belgium), 0.002 U purified Castellaniella defragrans geraniol dehydrogenase ...
-
bioRxiv - Biophysics 2019Quote: Isolated islets were loaded with 4 µM Fluo-4 AM (Invitrogen) for 45min at 37°C in imaging medium (125mM NaCl ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... isolated with Protein A Dynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 3:1 ratio with 1X penicillin/streptomycin (Gibco; 15070) and 5% FBS (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... in Fibroblast medium (3:1 DMEM: Ham’s F12 Nutrient Mixture, Gibco) supplemented with 10% FCS ...