Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 10000+ citations for Pig Histone H3.3 H3F3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and a cDNA kit (ThermoFisher). Primers for qPCR were ATTTTCGGCTCATTCTTCACACT (forward ...
-
bioRxiv - Immunology 2022Quote: ... purified (Megaclear RNA kit, Ambion) and analyzed on Experion (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... and TURBO DNA kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... the Superscript II kit (Invitrogen) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... Qubit protein assay kit (Invitrogen) was used to obtain protein concentration ...
-
bioRxiv - Microbiology 2019Quote: ... using the MICROBEnrich kit (Ambion) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Commercially available kits from ThermoFisher (t-tau ...
-
bioRxiv - Molecular Biology 2019Quote: ... using MaxiScriptT7 kit (Invitrogen, AM1320). Purified m6A-containing products were serially diluted in non-m6A containing products.
-
bioRxiv - Biophysics 2020Quote: ... The mMessage mMachine kit (Ambion) was used to make mRNA as per the manufacturer’s protocol and cleanup using RNAeasy kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Neon Transfection Kit (Invitrogen) was used to transfect cells with CRISPR-mCherry (mCh ...
-
bioRxiv - Genomics 2019Quote: ... RNaqueous kit from Ambion (#AM1912); Torin 1 from Tocris (#4247) ...
-
bioRxiv - Microbiology 2019Quote: ... The Ribominus kit (Life Technologies) was used to remove rRNA from total RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Assay Kit (Invitrogen, Paisley, UK).
-
bioRxiv - Biochemistry 2021Quote: ... or MEGAscript T3 kit (Invitrogen) with α-32P UTP ...
-
bioRxiv - Biochemistry 2021Quote: ... The Superscript IV kit (Invitrogen) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Aqua LIVE/DEAD kit (Invitrogen) was used to exclude dead cells ...
-
bioRxiv - Cell Biology 2021Quote: ... BacMam 2.0 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The MegaScript T7 kit (Ambion) was then used to perform in vitro-transcription ...
-
bioRxiv - Developmental Biology 2020Quote: ... MEGAscript RNAi Kit (Thermo Fisher) was used to generate dsRNA to target exon 5-8 of Nvtra mRNA in 4th larval instar females which resulted in a male splice form of NvDsx as shown in Verhulst et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... with MEGAscript T3 kit (Ambion). sgRNA (50 pg each ...
-
bioRxiv - Developmental Biology 2021Quote: ... The Superscript III kit (Invitrogen) was used to synthesize cDNA for qPCR using random hexamer primers ...
-
bioRxiv - Genetics 2021Quote: ... Turbo DNA-free kit (Ambion) was used to eliminate genomic DNA from the samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the RiboPure kit (Ambion) followed by DNase treatment (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... TURBO DNA-free kit (Thermofisher) was used to remove DNA and the RNeasy MinElute Cleanup kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: The MEGAshortscript kit (Life Technologies) and pTRI-β-actin-human template (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... A FoxP3 staining kit (Invitrogen) was used for staining CTLA4 ...
-
bioRxiv - Immunology 2020Quote: ... or miRVana isolation kit (Ambion). RNA quality was checked at Bioanalyser before library preparation ...
-
bioRxiv - Developmental Biology 2021Quote: DNAzol® Reagent kit (Invitrogen Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... NucAwayTM Spin column kit (Ambion) was used to remove unlabeled free nucleotides based on the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... a PureLink RNA kit (Invitrogen) or a Quick-RNA kit (Zymo Research) ...
-
bioRxiv - Cell Biology 2022Quote: ... SP6 mMessage mMachine Kit (Ambion) was used and mRNAs were injected via glass capillaries (30-0020 ...
-
bioRxiv - Microbiology 2022Quote: ... using the Generacer kit (Invitrogen) and specific RACE primers for bfrG and cruR according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... purified (Megaclear RNA kit, Ambion) and analyzed on Experion (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... or manual extraction kits (Invitrogen PureLink genomic DNA kit or the Sigma GenElute kit) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... After 24 hours of treatment RNA was extracted by Invitrogen Purelink RNA Mini Kit (Invitrogen). All groups were tested in triplicates.
-
bioRxiv - Molecular Biology 2022Quote: PureLink RNA Micro Kit (Invitrogen) was used to isolate RNA according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Pierce Fab Preparation Kit (ThermoFisher) was used to generate Fab fragments of anti-Flag IgG antibody ...
-
bioRxiv - Microbiology 2024Quote: ... using the KinaseMax Kit (Invitrogen) according to the manufacturer’s suggestions ...
-
bioRxiv - Physiology 2024Quote: ... Amplification Grade Kit (Invitrogen, #18068015), followed by the iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and TurboDNAse (Ambion DNAfree kit) on the total amount of eluate to eliminate residual DNA ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA MiniPrep Kit (Invitrogen). E ...
-
bioRxiv - Cancer Biology 2024Quote: ... and miRNA isolation kit (Ambion). The quality of RNA was checked using Bioanalyzer RNA 6000 Nano kit (Agilent) ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... Lipofectamine 2000 Kit (Invitrogen, 11668019) was used for the delivery of siRNAs according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... GeneJet Kits (Thermo Fisher Scientific) were used for PCR product purification and minipreps ...
-
bioRxiv - Synthetic Biology 2023Quote: ... FirstChoice RLM-RACE Kit (Invitrogen), gene specific antisense and inner antisense primers were used to obtain 5’ sequences ...
-
bioRxiv - Molecular Biology 2022Quote: ... with HuMEC Supplement Kit (ThermoFisher) and passaged at a 1:5 ratio every 72 hours ...
-
bioRxiv - Microbiology 2022Quote: ... version 2.0 kit (Invitrogen, USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Zero Blunt TOPO kit (Invitrogen) was used for ligation and further amplification of PCR products ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lipofectamine™ RNAiMAX kit (Invitrogen) was used to transfect 10 nM si-ULK1 into HK-2 cells for experiments ...
-
bioRxiv - Developmental Biology 2023Quote: ... the mMessage mMachine Kit (Ambion) was used ...