Labshake search
Citations for Thermo Fisher :
2151 - 2200 of 10000+ citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... A NanoDrop One (ThermoFisher Scientific, Waltham MA) spectrophotometer was used to quantify the genomic DNA and determine 260/280 and 260/230 nm ratios ...
-
bioRxiv - Microbiology 2022Quote: ... coli DH5α One Shot Top10 cells (Invitrogen). Transformants were selected based on Zeocin resistance (25 μg mL−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x Culture One (Gibco, #A33202-01) in Neurobasal-A (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... One µl of GlycoBlue co-precipitate (Invitrogen) was added to each sample and mixed well before the addition of 250 µl of isoproponol ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a NanoDrop One Spectrophotometer (ThermoFisher Scientific). Equal amounts of protein (0.25 µg ...
-
bioRxiv - Microbiology 2023Quote: ... coli One Shot BL21 (DE3) (Life Technologies). The ARH1 D55,56A ...
-
bioRxiv - Plant Biology 2022Quote: ... a NanoDrop One spectrophotometer (Thermo Fisher Scientific) and Qubit 3.0 Fluorometer (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... One Shot BL21(DE3) (Invitrogen, 44-0184), OverExpress C43 (DE3 ...
-
bioRxiv - Genetics 2023Quote: ... and quantified with NanoDrop One (Thermo Fisher). One μg of the DNA was used as template for dsRNA synthesis using MEGAscript T7 Transcription kit (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain One Shot™ TOP10 (Invitrogen) for plasmid amplification or BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... One Shot competent cells (Thermo Fisher Scientific) were transformed and candidate colonies were verified by diagnostic digestion ...
-
bioRxiv - Genetics 2023Quote: ... transformation was performed (One Shot Stbl3, Invitrogen). The inserted gRNA sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... with One Shot™ TOP10 (ThermoFisher Scientific) for allele-specific sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... and one µL GlycoBlue (Fisher Scientific, #AM9515) was added to seventy µL of the extracted aqueous phase ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Genomics 2023Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Genetics 2023Quote: ... and quantified using Nanodrop One (Thermo Scientific). 100 nanograms for each of the three replicates from every sample were then used as a starting material to generate RNA-seq libraries following the Universal RNA-seq with NuQuant protocol (Tecan) ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing one-part DMEM (Fisher Scientific; 41966029) and one-part DMEM/F12 (Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... FBS One Shot (1X, Thermo Fisher Scientific), Glutamax (1X ...
-
bioRxiv - Molecular Biology 2024Quote: ... quantified as IgG in Nanodrop One (Thermofisher) and stored at –20°C until further use.
-
bioRxiv - Biophysics 2019Quote: ... 0.45% D-glucose and 1 mM L-glutamine (all products from Gibco unless specified). The medium was changed every 2-3 days.
-
bioRxiv - Developmental Biology 2021Quote: ... Dead cells were excluded either via 7-aminoactinomycin D staining 1:1000 (7AAD, Invitrogen) or Sytox AAD (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... primary antibody used was mouse anti-HuC/D (1:500; 16A11, Molecular Probes, USA), which was detected using Alexa Fluor 555 conjugated goat anti-mouse IgG diluted 1/1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mL media (Dulbecco’s modified Eagle’s media (DMEM, 1 g/L D-Glucose; Invitrogen) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... cells were lysed in 1% n-Dodecyl-β-D-Maltoside (DDM, Thermo Scientific #89903) in lysis buffer (30 mM Tris pH 7.4 ...
-
bioRxiv - Cell Biology 2024Quote: ... port D was loaded with 0.2 μg ml−1 Hoechst 33342 (Thermo Scientific, #H3570) to allow for determination of the cell count via de Cytation 5 image reader and normalisation of the OCR to the cell number.
-
bioRxiv - Bioengineering 2021Quote: ... a 6 well plate containing 6 mL FACS Clean (Thermo Fisher, BD 340345), 6 mL FACS Rinse (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and labelled with 0.7 μM 6-carboxyfluorescin dictate (6-CFDA; Thermo Fisher Scientific) for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... high dose IL-6 stimulation received 100 ng/ml IL-6 (Gibco; PHC0066) or 100 pM acetic acid vehicle stimulation for either 3-or 24-hours and immediately collected for analysis ...
-
bioRxiv - Immunology 2022Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S ‘2P’ and HexaPro IMAC elution fractions were concentrated to ∼ 1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Immunology 2020Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S-2P IMAC elution fractions were concentrated to ~1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pierce premium grade N-hydroxysulfosuccinimide (sulfo-NHS, PG82071) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 22980) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products (1□μg) of desired templates were 3’ end-labeled using a Pierce biotin 3’ End DNA Labeling Kit (Thermo Scientific). The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA) ...
-
bioRxiv - Immunology 2023Quote: ... viable CD45-CD34+Sca-I- cells were sorted from epidermal single cell suspensions of 1-month-old EGFRΔEgr2 (n=3) and littermate controls (n=3) into Trizol LS Reagent (Thermo Fisher Scientific) using a FACS Aria III ...
-
bioRxiv - Microbiology 2023Quote: ... cells were blocked for 1 h in 3% BSA/PBS and incubated with rabbit-anti-GFP (1:50 in 3%BSA/PBS, 200 µl/well, Invitrogen, G10362) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-mouse Alexa-Fluor 488, 1:500, Thermofisher Scientific, 4 hrs at RT; Th: goat anti-rabbit Alexa-Flour 488, 1:500, Thermofisher Scientific, 4 hrs at RT). Sections were mounted on gelatin subbed slides and coverslipped with VectaShield anti-fade mounting medium (Vector Labs).
-
bioRxiv - Cell Biology 2019Quote: ... For the negative control primary antibodies mouse anti-plasmepsin V (From D. Goldberg, 1:1) and rabbit anti-GFP A-6455 (Invitrogen, 1:200) were used.
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Neuroscience 2021Quote: ... The nuclei of astrocytes and autaptic neurons were visualized by counterstaining with 4’,6-diamidino-2-phenylindole (DAPI)-containing mounting medium (ProLong® Gold Antifade Reagent with DAPI, Thermo Fisher Scientific). Only neurons with one nucleus were analyzed when counting synapse numbers.
-
bioRxiv - Microbiology 2022Quote: ... 0.1% Triton X-100 in PBS for 20 minutes, then were actin stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) nucleic acid stain (Thermo Fisher Scientific, USA) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were again washed and incubated for 10 min in a solution of 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific). Cells were imaged using a Leica DM IRB epifluorescence microscope ...
-
bioRxiv - Developmental Biology 2019Quote: ... After 4 days the embryoid bodies were transferred to 24 well or 6 well plates coated with collagen (Thermo Scientific®; A10483-01) containing Melanocyte conversion media (45% DMEM – High glucose ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... sections were rinsed three times for 10 min each and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Immunology 2020Quote: ... A viability dye was included in all Duraclone panels (Live/dead fixable dead cell stain kit from ThermoFisher Scientific or DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate from ThermoFisher Scientific (Courtabœuf, France)) ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa-Fluor 594 labelled goat anti-rabbit IgG, ProLong Gold antifade reagent with DAPI (4’, 6-diamidino-2-phenylindole) (Life technologies-Invitrogen, USA), ATP Affinity kit (no ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were rinsed three times with 1X PBS and coated with ProLong Gold antifade mounting medium with DAPI (4’,6-diamidino-2-phenylindole, 100 ng/ml) (Life Technologies, P-36931) on slides ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...