Labshake search
Citations for Thermo Fisher :
2101 - 2150 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% SDS (Affymetrix USB Products, 151-21-3), 1 mM PMSF (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... in a QuantStudio 3 realtime system (Applied Biosystems). The Cq value of each gene was normalized to the Cq value of GAPDH.
-
bioRxiv - Neuroscience 2023Quote: ... and viability was automatically counted (Countess 3, Invitrogen).
-
bioRxiv - Bioengineering 2023Quote: ... using a QuantStudio 3 PCR system (Thermo Fisher). Adipogenic genes tested included Peroxisome proliferator-activated receptor gamma (PPAR-G) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-V5 (Invitrogen, #R96025, 1:800, 3 days), anti-cFOS (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... and an Applied Biosystems QuantStudio 3 (Applied Biosystems). Previously described primer sets (see Supplemental File 4 for sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 min incubation in 3% H2O2 (Fisher Scientific) was performed ...
-
bioRxiv - Cell Biology 2023Quote: ... or 10µM TOTO-3 (Molecular Probes, Eugene, OR) in dPBS for 15 minutes at room temperature in the dark ...
-
bioRxiv - Immunology 2023Quote: ... cells were loaded with Fluo-3-AM (Invitrogen) at 37°C for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... Cell number was determined by Countess 3 (Invitrogen) and was used to normalize oxygen consumption rate in pmoles/min.
-
bioRxiv - Cell Biology 2024Quote: ... Amp-3 and HRP-tagged probe (ThermoFisher Inc) for 30 ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI; Invitrogen) while Ud23 and Ud26 IAV were labeled with a different lipophilic dye with a longer excitation and emission wavelength ...
-
bioRxiv - Physiology 2024Quote: ... using the Quant Studio 3 system (Applied Biosystems). qPCR reactions were prepared in a final volume of 20 μl containing 2 μl cDNAs ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 g/L D-glucose (Thermo Fisher, A2494001), 0.5% NEAA (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... CD223 (LAG-3) (Invitrogen, eFluor 450, clone 3DS223H), TIGIT (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 mM L-glutamine (Gibco, 25030-024) or in phenol red-free DMEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: Pierce RNA 3’ End Desthiobiotinylation Kit (Thermo Scientific) was used for the biotinylation of the transcribed RNA for the pulldown experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... incubated with 3% hydrogen peroxide (Thermo Fisher Scientific) in TBS and blocked with Avidin and Biotin (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3 µl of TURBO RNase (Thermo Fisher) were added and incubated at 37°C for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were stained in 3 μM DAPI (Invitrogen). Flow Cytometry was completed on BioRad ZE5 Cell Analyzer or BD Biosciences LSR15 cytometer ...
-
bioRxiv - Physiology 2024Quote: ... and the QuantStudio 3 thermocycler (Thermofisher Cat. #A28567) using manufacturers instruction ...
-
bioRxiv - Physiology 2024Quote: ... and the QuantStudio 3 thermocycler (Thermofisher Cat. #A28567) using manufacturers instruction ...
-
bioRxiv - Neuroscience 2024Quote: ... 18 µl of 3 M sodium acetate (Ambion), and 2 µl of 10 mg/ml glycogen ...
-
bioRxiv - Cell Biology 2024Quote: ... or a 3-8% Tris Acetate gel (Invitrogen). Proteins were wet transferred onto a PVDF membrane (Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... on the Qubit 3 Fluorometer (Q33216; Life Technologies). Total Rubisco content was measured by 14C-CABP binding as previously described (Ruuska et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... and Qubit 3 Fluorometer (Thermo Fisher, Waltham, USA), respectively.
-
bioRxiv - Cancer Biology 2024Quote: ... cell media were supplemented with Pen Strep (100 U/mL penicillin and 100 ug/mL streptomycin, Gibco).
-
bioRxiv - Immunology 2024Quote: ... supplemented with 20% FBS and 100 IU/mL penicillin and 100 ug/mL streptomycin (Gibco or Corning) and passaged every 2-3 days ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 ug/ml of Penicillin/Streptomycin (Gibco, catalog number 15140-122) and 500 ug/ml Geneticin (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... and 100 ug/mL streptomycin (Thermo Fisher Scientific, Cat#15140-122). All cells used were maintained at 37°C with 5% CO2.
-
bioRxiv - Molecular Biology 2019Quote: ... 100 nM of scrambled ASO or 7SK 3’ ASO (IDT) were transfected using Lipofectamine 2000 (Invitrogen) using the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... 50-100 ng sheared DNA was quantified by Qubit™ 3 Fluorometer (Thermo Fisher Scientific™) and was input for library preparation with MGIEasy universal DNA library kit (MGI) ...
-
bioRxiv - Microbiology 2022Quote: ... Supplementary Table 3) and added (100 μL/well) to ELISA plates (Maxisorp Nunc-immuno plates; Thermo). Since Iwate/2019(H3N2 ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 mM DTT] and separated on a 3–8% Tris-acetate NuPAGE gel (Thermo Fisher Scientific) for RdRp ...
-
bioRxiv - Physiology 2023Quote: ... Frozen endothelial cells were sonicated 10 times on setting 3 (Sonic Dismembrator Model 100, Fisher Scientific) in the proprietary lysis buffer provided with protease inhibitors (10 µM leupeptin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Acclaim PepMap 100 C18 LC column (3 μm, 75 μm × 20 mm, Thermo Scientific P/N16496) and analytical column ...
-
bioRxiv - Systems Biology 2023Quote: ... ∼3 million cells were plated in a 100 mm culture dish (Thermo Fisher, 12-567-650) coated with 0.001% poly-D-lysine (Sigma Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... + hydrogen peroxidase 3% (1:100, Alexa Fluor 488 Tyramide SuperBoost Kit, goat anti-rabbit IgG, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MK pellet was resuspended in 100 μL PBs containing 3% bovine serum (BSA; Fisher Scientific) for antibody labeling.
-
bioRxiv - Neuroscience 2024Quote: ... or anti-occludin (1:100 in 3% BSA in TBS; Thermo Fisher Scientific, Cat# 71-1500) overnight at 4°C in a humidified atmosphere ...
-
bioRxiv - Cell Biology 2019Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Microbiology 2019Quote: ... The membrane was stained with 5 μg/ml FM 4-64FX (Invitrogen) fluorescent dye while the nucleoid was stained with 2 μg/ml DAPI (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Cancer Biology 2022Quote: ... 5 ng/ml IL-4 (Thermo Fisher Scientific, Cat#14-8041-62) and 1 ng/ml TGF-β1 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... and passaged every 4-5 days with 1 mg/ml Dispase (Gibco). The human FUSWT line ...
-
bioRxiv - Neuroscience 2020Quote: ... slides were washed 3×5 min in PBST and incubated with secondary antibodies (chicken anti-goat IgG Alexa Fluor 488 (ThermoFisher: A-21467, 1:1000) in blocking buffer for 2 hr at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... NCRM1 iPSCs were transfected with both Guide RNA vector (PSpCas9 (BB)-2A-GFP) and targeting vector (pUC19-5’HA-H2B-mCherry-P2A-3’HA) using Lipofectamine™ Stem Transfection Reagent (Thermo Fisher Scientific, STEM00001). 24-hours after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... elegans cel-miR-67 (5’ UCACAACCUCCUAGAAAGAGUAGA 3’), using INTERFERin®-HTS transfection reagent (Polyplus-transfection SA, Illkirch France) or Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific Inc.). AntimiRs were used at a final concentration of 75 nM and transfections were performed according to the manufacturer’s instructions ...