Labshake search
Citations for Thermo Fisher :
2101 - 2150 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal mounting media (Thermofisher, 8312-4) was placed on each slide ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% Primocin (Invivogen #ant-pm-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% L-glutamine and 2% penicillin/streptomycin (Invitrogen, Paisley, UK). All cells were incubated at 5% CO2 in a humidity-controlled environment (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... transfection reagent (1:2 µg:µL ratio) in Opti-MEM (Gibco), serial diluted in 4-fold increments (1µg to 0.016µg RNA final) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2) streptavidin conjugated with Alexa Fluor488 (1:1000) (Thermofisher Science), or 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg GFP plasmid and 2 μl Lipofectamine 2000 (Thermofisher) with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separate with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separatetubes and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Physiology 2021Quote: ... with 2 μM JC-1 dye (M34152, Thermo Fisher Scientific) at 37 °C in a 5% CO2 incubator for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and diamidino-2-phenylindole (DAPI) (1:500, Thermo Scientific, 62247).
-
bioRxiv - Microbiology 2021Quote: ... BMDMs were treated with 1 mM 2-DG (Life Technologies) dissolved in medium without glucose for 2h prior to infection ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 ng mL−1 bFGF (Cat. no. 233FB025CF, Fisher Scientific), and 10 μM all-trans retinoic acid (Cat ...
-
bioRxiv - Immunology 2021Quote: ... diluted 1:2 with PBS with Ca2+Mg2+ (Thermo Fisher) was added to the cells and incubated in the dark for 15 min before reading on a Synergy H1 Hybrid Multi-Mode plate reader (Biotek) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... 1% Penicillin-Streptomycin and 55 µM 2-Mercaptoethanol (all Gibco) supplemented with 4% FLT3L supernatant (generated from the cell line CHO flag Flk2.clone5 kindly provided by Prof Nic Nicola ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Immunology 2021Quote: ... lymphocytes were labeled with CellTracker dyes (Invitrogen, 1-2 μM). LF chips were fixed by filling the perfusion channel with 4% paraformaldehyde in phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: ... in a 1:2 ratio in Opti-MEM media (Gibco) as previously described [59].
-
bioRxiv - Neuroscience 2022Quote: ... L-glutamine (2 mM) and Na+ pyruvate (1 mM) (Invitrogen). After attachment for 3–4 h ...
-
bioRxiv - Biochemistry 2023Quote: ... MCF7 [RPMI (Gibco 21870 + 2 mM glutamine + 1 mM pyruvate)] ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM Glutamax) plus 1× N2 (ThermoFisher Scientific 100×, 17502048), 1× B-27 (ThermoFisher Scientific 50X ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Penicillin/Streptomycin/Glutamine and 1% Insulin-Transferrin-Selenium (Gibco). After 3 days ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1 mM tris(2-carboxyethyl) phosphine (TCEP) (Thermo Scientific) and protein concentration was estimated on a UV-Vis Spectrophotometer at 280 nm ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 1% or 2% foetal bovine serum (Gibco; #10437-028) for 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... CDS of interest were inserted into pDONR221[1-2] (Invitrogen); and preexisting 3’UTR regions of commonly used genes (unc-54 ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Microbiology 2023Quote: ... and Alexa Fluor 488 (1:750, 2 hrs; Invitrogen A11005). Antibodies were incubated with agitation at 37° C ...
-
bioRxiv - Microbiology 2023Quote: Pure Fe0 granules (10 g; 1-2 mm; Thermo Scientific) or 316 L stainless steel (12 pieces ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSC were resuspended in 1-2 mL of Stemflex (ThermoFisher) with 10µM RI and counted ...
-
bioRxiv - Bioengineering 2022Quote: ... and 2 µL/mL ethidium homodimer-1 (Life Technologies, Germany) in DPBS ...
-
bioRxiv - Neuroscience 2024Quote: ... at 1:250) paired with (2⁰ Streptavidin-633 (Invitrogen #S21375) 1:500).
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2% (v/v) 1 M HEPES (ThermoFisher Scientific, #15630080).
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM L-glutamine and 1% nonessential amino acids (Invitrogen) (DMEM complete ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... 1% (vol/vol) l-glutamine (2 mM final concentration; Gibco), and 1% (vol/vol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Superase*In (2 uL per 1 mL; Thermo Fisher). The lysate was centrifuged at 3,000 g for 3 minutes at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μl of 1 μM Qdot 655 Streptavidin Conjugate (ThermoFisher) was incubated with 2 μl of 100 nM biotinylated kinesin-543 and 6 μl of Buffer 1 on ice for 1 hour prior to experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 2 mM glutamine and 1% penicillin/streptomycin (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco) and 50 µM 2-Mercaptoethanol (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 mM L-glutamine,1% (v/v) penicillin/streptomycin(Gibco)) and 2 million cells were seeded in 6cm collagen I-coated dish (BD BioCoat) ...