Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 10000+ citations for Human KIRREL shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The supernatants of human CD19 CAR T cells or human TCR transfected CD8+ T cells were analyzed by IFNγ Human Uncoated Elisa Kit (Invitrogen, Thermo Fisher Scientific # 88-7316-88). Plates were read on BioRad plate reader at a wavelength 450 nm and subtracted by 595 nm.
-
bioRxiv - Molecular Biology 2022Quote: Female human embryonic kidney cells HEK-293FT and male human fibrosarcoma HT1080 cells were cultured in DMEM-GlutaMAX + Pyruvate (Life Technologies SAS, Saint-Aubin, France), supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2019Quote: ... was performed using the TaqMan gene expression assays (EFHA1/Micu2 rat: s235193; EFHA1/Micu2 human: s47976; Hprt1 rat: Rn01527840; Hprt1 human: Hs99999909, Applied Biosystems, Life Technologies, Carlsbad, CA), using a 7900HT Fast Real-Time System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: Human promyelocytic leukemia (HL-60) cells and human umbilical vein endothelial cells (HUVECs) were grown in RPMI-1640 medium (Gibco, Thermo Scientific, MA, United States) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... the blots were probed for the presence of heavy and light chain bands using either horseradish peroxidase (HRP)-conjugated polyclonal goat anti-human IgG Fc antibody or polyclonal goat anti-human kappa chain antibody (Thermo Fisher Scientific, Waltham, MA, USA). Antibody-coupled HRP activity was detected with Supersignal West Dura Extended Duration Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... or pMK-RQ (EtIMP1Cit) plasmid with appropriate restriction enzyme sites for cloning into pYD1 yeast display plasmid vector (Invitrogen, Thermofisher Scientific, Waltham, MA, USA). A NotI restriction site was included between each antigen sequence and the 3’citrine tag ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 105 cells were transfected with the appropriate plasmid combinations or plasmid/siRNA combinations using the Neon Transfection System (Thermo Fisher, Waltham, MA, USA) and a 10 µL Neon tip at 1000 V ...
-
bioRxiv - Immunology 2022Quote: ... 12μg heavy chain plasmid and 12 μg of light chain plasmid were added into 3ml of Opti-MEM™ (Thermo Fisher Scientific cat.# 31985070), after inverting ...
-
bioRxiv - Immunology 2023Quote: ... Sequence-verified Cas9-gRNA-Puro plasmids and pMA donor plasmid were co-transfected into in-house C57BL6/N 6.0 ESC using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) prior to selection with 2 μg/ml puromycin for 48 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 100 ng/well of either TOP luciferase reporter plasmid or the negative control FOP plasmid using Lipofectamine™ LTX Reagent with PLUS™ Reagent (Invitrogen, Carlsbad, US) in serum-free Opti-MEM® medium (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retrovirus was generated by transfecting oncogenic plasmids and viral packaging plasmid (pCL-Ampho) into phoenix cells with Lipofectamine 2000 (Life Technologies, Grand Island, NY). Viral particles were incubated with prostate cells (70% confluence ...
-
bioRxiv - Immunology 2021Quote: ... at 4°C with 2µg anti-CD3 (mouse: eBioscience 14-0031-86; human: eBioscience 16-0037-85) and 1µg anti-CD28 (mouse: Invitrogen 14-0281-86; human: 16-0289-85) and either 7µg of Recombinant PD-L1/B7-H1 Fc Chimera Protein (mouse ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cDNA plasmids in pcDNA™4/TO Mammalian Expression Vector were transiently transfected into Expi293F™ cells stably expressing human FHF2b and human SCN1B subunit (polyclonal) background using ExpiFectamine™ 293 Transfection Kits (Gibco,Thermo Fisher Scientific CAT #: A14524). Induction was achieved using Tetracycline (Sigma Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... The supernatants of human CD19 CAR T cells or human TCR transfected CD8+ T cells were analyzed by IFNγ Human Uncoated Elisa Kit (Invitrogen, Thermo Fisher Scientific # 88-7316-88). Plates were read on BioRad plate reader at a wavelength 450 nm and subtracted by 595 nm.
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were transiently expressed with Lipofectamine 2000 or 3000 (Invitrogen) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfection with Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) was conducted 48 h after brown adipocytes were induced to differentiate ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen) following the manufacturer’s recommendations into HEK293T cells at 50% confluence the day of transfection along with lentiviral packaging plasmids pVSVg (3.5 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... transient transfections of plasmids were performed using Lipofectamine 2000 (Invitrogen) and cells were assayed 72 h post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and then cloned into the pENTR Gateway plasmid system (Invitrogen). The Entry plasmids were then recombined using the Gateway recombination cloning system (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA was transfected with Lipofectamine 2000 (Thermo Fisher Scientific) in U2OS cells according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transiently transfected with Lipofectamine 2000 (Thermo Fisher Scientific) according to the instruction of the manufacturer or with 10 mM PEI (Polyethylenimine ...
-
bioRxiv - Cell Biology 2020Quote: ... we used mito-mCitrine plasmid with TurboFect (ThermoFisher Scientfic, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... The donor plasmid was assembled by MultiSite Gateway cloning (Invitrogen) and contained a GFP transcription unit under the control of the 3xP3 promoter enclosed within two reversible ϕC31 attP recombination sequences flanked both 5′ and 3′ by 2 kb sequence amplified using primer 29113 ex5 B1 f (CAACCAAGTAGTTACTGTGCTC ...
-
bioRxiv - Microbiology 2019Quote: ... we digested plasmids using EcoRI (Invitrogen™ Anza Restriction Enzyme). For the hCYTB484 assay ...
-
bioRxiv - Molecular Biology 2021Quote: All plasmids were transfected using Lipofectamine 2000 (Life Technologies, 11668019) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... and plasmid DNA were diluted in Opti-MEM (31985070, Gibco) to a final DNA:Lipofectmine ratio of 1:3 and incubated at room temperature for 5 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Control plasmids from ProQuest™ two-hybrid system (Life Technologies). Co-transformation with empty prey vector was used as negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... All plasmids were grown in DH5a competent cells (Life Technologies) and purified using endotoxin-free maxiprep kits (Qiagen).
-
bioRxiv - Molecular Biology 2020Quote: ... PRF reporter plasmid DNAs were transfected using Lipofectamine 2000 (ThermoFisher) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid concentrations were measured using a Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... and 260 ng pMD.G envelope plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with purified plasmids using lipofectamine 2000 (Invitrogen) (with a ratio of 1 µg DNA ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... PShuttle-CMV plasmids were then digested overnight with MssI (ThermoFisher) and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were selected for plasmid integration with geneticin (G418, ThermoFisher). MDCK Claudin-quintuple knockout (Cldn-qKO ...
-
bioRxiv - Microbiology 2020Quote: ... Minipreps were done using GeneJET Plasmid Miniprep Kit (Thermo Scientific) and quantified by NanoDrop ...
-
bioRxiv - Cancer Biology 2020Quote: The plasmid DNA was quantified using a NanoDrop spectrophotometer (Thermofisher), all the preps were adjusted to the same concentration of 25 ng/μl ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid DNA was prepared in OptiMEM (Cat.# 31985070, Thermo Fisher). To produce virus for STEMCCA expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with LacR plasmid using Lipofectamine 2000 (Invitrogen) for 48 hrs ...
-
bioRxiv - Developmental Biology 2019Quote: ... A pCS2vegfcCDS plasmid was produced using Gateway LR clonase (Invitrogen). Capped mRNA was transcribed from a Not1-linearised template using the mMessage mMachine Kit (Ambion).
-
bioRxiv - Synthetic Biology 2019Quote: ... coli cultures using the PureLink Quick Plasmid Miniprep Kit (ThermoFisher). Input PCR products were purified using the GeneJet PCR purification kit (ThermoFisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... mESCs were transfected with plasmid vectors using Lipofectamine 2000 (Invitrogen) and then seeded at low density on dishes coated with feeder cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for plasmids and Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) for siRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmids were amplified using DH5α competent cells (Thermo Fisher Scientific) and purified with Endofree plasmid maxi kit (Qiagen).
-
bioRxiv - Cancer Biology 2019Quote: ... DNA plasmids were transfected into Oneshot Stbl3 Competent Cells (Invitrogen) using the heat shock method ...
-
bioRxiv - Microbiology 2019Quote: ... and ligated into the plasmid vector pCRII-TOPO (Invitrogen, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The SUMO sequence was amplified from the petSUMO plasmid (Invitrogen) by PCR with Q5 polymerase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher). The standard culture medium was replaced after 12 h by culture medium with 30% FCS ...
-
bioRxiv - Systems Biology 2021Quote: ... plasmids were transfected using Lipofectamine LTX with PLUS™ (Invitrogen). Transfections were performed in 12-well plates with ~80% cell confluency at transfection ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The modified plasmid (pUG015) was digested with BglII (ThermoFisher, FD0083) and Gibson Assembly (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: Residual plasmid DNA was removed using DNaseI (Amplification Grade, Invitrogen) according to the manufacturer’s protocol from 600 ng of the extracted RNA ...