Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 10000+ citations for 6 1 4 Dioxa 8 azaspiro 4.5 dec 8 yl 3 pyridinyl boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... Antibodies were used together with DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific, 62248, 1:1,000 dilution). NDE1 (Abnova ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... The assay is based on the dilution of co-mixed N-(7-nitro-benz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (N-NBD-PE) and N-(lissamine Rhodamine B sulfonyl)phosphatidylethanolamine (N-Rh-PE) (Molecular Probes, Eugene, OR, USA), whereby dilution due to membrane mixing results in increased N-NBD-PE fluorescence ...
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) was applied to nuclei samples at a concentration of 0.1µg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher), rinsed with TBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Bioengineering 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, NucBlue Fixed, Life Technologies) for cell count and nuclear aspect ratio ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI;ThermoFisher) and mounted with Vectashield H1400 Hardset Mounting Medium (Vector Labs) ...
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4’,6-diamino-2-phenylindole, Life Technologies, Ref#D3571) and Calcein AM staining profiles and Calcein AM (Life Technologies ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen Cat. D1306), was added ...
-
bioRxiv - Microbiology 2023Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) and LACV antibody as described below ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Cancer Biology 2022Quote: ... HCT-116 and Panc-1 cells were cultured in high-glucose (4.5 g L−1) Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Lot 134874), and 4-(2-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, purity ≥ 99.%, CAT #BP310-1, Lot 052975) were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genomics 2021Quote: ... and then blocked for 1 hour with 1 ml of blocking buffer (wash buffer containing 3% fatty acid free BSA (Thermo Fisher, 126609)) ...
-
bioRxiv - Biophysics 2021Quote: ... Secondary antibodies were goat anti-mouse-Star red (Abberior, 2-0002-011-2) and goat anti-rabbit Star 580 (Abberior 2-0012-0050-8) (Life Technologies, 1:100).
-
bioRxiv - Cell Biology 2019Quote: ... five day 1 adult males were dissected in 35μL pH 7.8 SM buffer (50mM HEPES, 50mM NaCl, 25mM KCl, 5mM CaCl2, 1mM MgSO4, 1mg/ml BSA) with JC-1(Thermo Fisher Scientific T3168) added to 10μM final concentration ...
-
bioRxiv - Molecular Biology 2021Quote: ... pombe cells were mixed in an 8:1 ratio and total RNA was extracted using reagents from RiboPure yeast kit (Thermo Fisher Scientific #AM1926) using the following volumes ...
-
bioRxiv - Immunology 2021Quote: ... The grid was then blotted for 3.0 s with a blot force of −1 at 8 °C and 100% humidity and plunge-frozen in liquid ethane using a Vitrobot (Thermo Fisher Scientific, USA). Cryo-EM data sets were collected at a 300 kV Titan Krios microscope (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The GMEM/KSR medium was consisted of 1 × Glasgow’s MEM (GMEM; Wako, 078-05525) supplemented with 8% KnockOut Serum Replacement (KSR; Thermo Fisher Scientific, 10828-028). In the initial optimization experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were 1:30 rat anti-N-cadherin (Developmental Studies Hybridoma Bank, DN-EX #8,) and 1:200 rabbit anti-lucifer yellow (Molecular Probes, A-5750). The secondary antibodies used were 1:500 goat anti-rabbit with Alexa fluor 633 (Molecular Probes ...
-
bioRxiv - Developmental Biology 2023Quote: ... Dissected tails were then placed in individual wells of 8-well glass-bottomed dishes (Lab-Tek Chambered #1 Borosilicate Coverglass System 155411, Thermo Scientific Nunc, USA) with 200µl of Gibco CO2 independent medium (Thermo Fisher #18045054).
-
bioRxiv - Cell Biology 2023Quote: ... qPCRs were performed using cDNA (1:8 dilution) and the ORA™ SEE qPCR Green ROX L kit (highQu) on a PikoReal 96 machine (Thermo Fisher Scientific). GraphPad Prism was used for graphics/statistics ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were sonicated on ice at 40% amplitude for one hour by a 120 W ultrasonicator with a 1/8” microtip probe (Fisher Scientific; Hampton, NH). Sonicated suspensions were ultracentrifuged at 58,000 x g for one hour using an Optima Max-XP Ultracentrifuge (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Microbiology 2021Quote: ... lysates were spun at 10,000 x g for 10 minutes at 4 °C prior to reaction with 4- acetamido-4’-maleimidyl-stilbene-2,2’-disulfonic acid (AMS) (ThermoFisher Scientific). AMS alkylation was performed by vortexing the lysates in 15 mM AMS ...
-
bioRxiv - Cancer Biology 2021Quote: ... fractionated into 8 fractions using the High pH Reversed-Phase Peptide Fractionation Kit (ThermoFisher Scientific 84868) according to the manufacturer protocol and dried ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines or patient samples were dissociated and labeled with 8 µM CFSE solution (Life Technologies). Stage HH14 chick embryos were grafted with fluorescent cells in presumptive somitic areas or in the brain parenchyma ...
-
bioRxiv - Immunology 2021Quote: ... Attached cells were then differentiated to macrophages by 8–9 d of culture in IMDM (Gibco)+ GlutaMax (Thermo fisher scientific ...
-
bioRxiv - Neuroscience 2022Quote: Paraffin embedded sections (8 μm) from caudate and putamen were cut using a microtome (Thermo Scientific). To remove paraffin wax ...
-
bioRxiv - Molecular Biology 2020Quote: The H1 hESC line was purchased from WiCell and cultured in Essential 8™ medium (ThermoFisher) on hLaminin521 (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... hiPSCs were propagated on Matrigel® coated tissue culture plates using serum-free essential 8 (Gibco) culture conditions in standard environments consisting of 5% carbon dioxide at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: Human astrocytes were plated onto 8 well chamber slides (Lab-Tek, Nunc, Thermo Scientific, cat# 177445) and were administered PFF conjugated with gold ...
-
bioRxiv - Cell Biology 2022Quote: Human astrocytes were plated onto 8 well chamber slides (Lab-Tek, Nunc, Thermo Scientific, cat# 177445) and were administered PFF conjugated with gold ...