Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for Mucin 1 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... The absorbance was measured with a microplate reader (Multiskan FC, Thermo Fisher Scientific). The concentrations of 11-KT were calculated using Arigo Biolaboratories GainData (https://www.arigobio.com/elisa-analysis).
-
bioRxiv - Genetics 2024Quote: ... with 10% fetal calf serum (FCS; Bio&Sell) and Penicillin-Streptomycin (Life Technologies) at 37°C / 5% CO2 ...
-
bioRxiv - Microbiology 2024Quote: ... The OD595 was measured using a microplate reader (Muktiskan FC, Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... Cell pellets were incubated with a 1:200 dilution of human cTnT primary mouse antibody (ThermoFisher) overnight at 4°C ...
-
bioRxiv - Neuroscience 2019Quote: ... or 10 μM of freshly prepared human synthetic amyloid-β peptide 1-42 (Aβ42, Life technologies) for 24 h as described (Kiyota et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant human TNF-α a well established trigger of HIV-1 reactivation was purchased from Gibco. The PKC activator Bryostatin and Sodium Butyrate (NaBu ...
-
bioRxiv - Microbiology 2020Quote: The human acute leukemia monocyte cell line (THP-1) was cultivated in RPMI 1640 medium (Invitrogen) supplemented with 10% heat-inactivated FBS (Thermo Scientific Hyclone ...
-
bioRxiv - Biochemistry 2022Quote: ... The ORF of human MYBL2/B-Myb isoform 1 (NM_002466.4) was cloned into pcDNA3.1+ (ThermoFisher Scientific) and fused with an N-terminal Flag tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mouse-anti-human H3K9/14/18/23/27ac (Thermo Fisher Scientific, Carlsbad, CA, USA; 1:500) was used to detect this histone modification in HPdLF and goat-anti-Mouse-Cy5 (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2021Quote: ... Alexa488- or Rhodamine-conjugated goat anti-human secondary antibody was added (1/500 dilution) (Thermo Fisher), and incubated for 2~3 hr at room temperature in the dark ...
-
bioRxiv - Molecular Biology 2021Quote: ... Immortalized human fibroblasts were cultured in DMEM (sigma) supplemented with 1% of penicillin and streptomycin (Gibco) and 10% fetal bovine serum (Corning ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with goat polyclonal anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific) for 1 hour at RT ...
-
bioRxiv - Immunology 2021Quote: ... plates were incubated with a goat anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific). For IgG subclasses and IgM detection ...
-
bioRxiv - Immunology 2021Quote: Human THP-1 cells (ATCC® TIB-202™) were cultured in RPMI media (22400089, ThermoFisher) supplemented with 1% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... diluted 1:3000 in blocking buffer or HRP-labelled goat anti-human IgM (Thermo Fisher Scientific) diluted 1:4000 at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD31-APC with human specificity for HUVEC experiments (1:500, Thermo Fisher Scientific, 17-0319-42) together with its IgG1 kappa APC-Isotype control (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng/mL human basic FGF2 (Miltenyi Biotech, 130-093-840) and kanamycin (Gibco, 15160-054). Culture medium was exchanged every 2 days ...
-
bioRxiv - Bioengineering 2023Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-human IgM and IgA (Invitrogen, A18835 and A18781, 1:5,000), rabbit anti-human IgG antibody (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding the ECR of human ADGRB2/BAI2 (aa 1-921) was synthesized by Thermo Fisher GeneArt ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-Human IgG (H+L) Alexa Fluor 488 conjugated (Invitrogen, A-11013, dilution 1:500); Donkey Anti-Mouse IgG H&L Alexa Fluor 647 conjugated (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-Human IgG (H+L) Alexa Fluor 488 conjugated (Invitrogen, A-11013, dilution 1:500). Data acquisition was performed with FACSVerse™ (BD ...
-
bioRxiv - Neuroscience 2024Quote: ... the mean fluorescence intensity (MFI) of Alexa488-coupled goat anti-human IgG (1:500; Life Technologies) was evaluated ...
-
bioRxiv - Cancer Biology 2023Quote: 1 × 105 OCSC1-F2 human OC cells were resuspended in serum-free Opti-MEM (Thermo Scientific) and seeded on trans-well inserts with a polyethylene terephthalate membrane pore size of 8.0 μm (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... A HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA, 88881, Life Technologies) enabled in vitro translation of these constructs ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with a goat anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific). For IgG subclasses and IgM detection ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples with 1×106 isolated human platelets were prepared in binding buffer (Invitrogen, Carlsbad, CA, USA). Hemin and CPR-XL were incubated at the indicated concentrations for 1h at room temperature.
-
bioRxiv - Neuroscience 2024Quote: Human primary Müller cells (P3) after siRNA treatments were incubated with JC-1 dye (#T3168, Invitrogen) at a concentration of 1.0 μg/mL in DMEM at 37 °C for 30 minutes to measure the mitochondrial membrane potential ...
-
bioRxiv - Cell Biology 2024Quote: ... PC3 cells were transfected with cDNA encoding human talin-1 (NM_006289) using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s recommendation ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with goat polyclonal anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific) for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2020Quote: HeLa and HEK293 cells were cultured at 37°C in an atmosphere of 5% CO2 in air in DMEM (Gibco, #10566024) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting HEK293 based stable cells were grown and maintained in adherent cell culture in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 9% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the EBV-positive Burkitt lymphoma cell line Raji and the HEK293-based EBV producer cell lines were maintained in RPMI medium 1640 (Life Technologies). HEK293T cells were maintained in DMEM (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: LC-MS/MS analyses were conducted using either a QExactive Plus Orbitrap (QE, RNase-digested polysomes) or a Velos Pro Elite Orbitrap (Elite, virus polysomes and HEK293 aggregates) mass spectrometer (Thermo Fisher) coupled online to a nanoAcquity UPLC system (Waters Corporation ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK ...
-
bioRxiv - Microbiology 2020Quote: HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: All E2 cores (E2c3, E2mc3, and E2mc3 v1-v10) and E2p-based nanoparticles were transiently expressed in HEK293 F cells (Thermo Fisher) for biochemical ...
-
bioRxiv - Immunology 2021Quote: ... IgGs and 6xHis-tagged Fabs were expressed by transient transfection of paired heavy chain and light chain expression plasmids into HEK293-6E or Expi293 cells (Life Technologies). Fabs and IgGs were purified from transfected cell supernatants using Ni-NTA (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... a heavy chain (HC) and light chain (LC) plasmid was generated for co-expression in HEK293 suspension culture cells (Expi293F cells) (Fisher Scientific). For species specificity swapping experiments ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... 293 cells from a pMLINK tetracistronic vector (courtesy of Y. Shi, Tsinghua University, Beijing).45 HEK293 cells were cultured in Freestyle 293 media (Life Technologies), shaking at 125 rpm while incubating at 37 oC with 8% CO2 until a density 2 × 106 cells/ml was reached ...
-
bioRxiv - Immunology 2021Quote: HEK293 cells were transiently transfected with SARS-CoV-2-S fragments expression vectors using Lipofectamine 2000 Transfection reagent (Thermo Fisher Scientific). Two days later ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 S gene containing plasmid p20017 and adenovirus backbone plasmid pAADV-C01 (Genemedi, China) were co-transfected into HEK293 based adapted viral production cell (ThermoFisher, USA). Viral production cells were seeded in a 6 well TC treated plate (Nest ...