Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for IL 4 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... This synthetized gene was cloned into the Champion™ pET302/NT-His expression vector (Thermofisher) via EcoRI and XhoI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme and Fc-portion was removed on HIS-Pur Ni-NTA resin (Thermo Fisher Scientific) and Protein G sepharose (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... the constructs were all based on a pcDNA3.1 vector containing a V5/His-tag (Invitrogen). Untagged constructs for comparison were prepared by introducing a stop codon into the pcDNA3.1/V5-His constructs using the same site-directed mutagenesis kit as above ...
-
bioRxiv - Microbiology 2022Quote: ... Then 1 μl of Dynabeads™ His-Tag Isolation and Pulldown magnetic beads (ThermoFisher Scientific) were added into each well ...
-
bioRxiv - Microbiology 2022Quote: ... 0.02% Tween-20) and added to 20 μl Dynabead His-Tag beads (ThermoFisher Scientific; 10103D). After incubation on a roller at 4°C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... VarG-HIS bands were excised and diluted with NuPAGE LDS sample buDer (Invitrogen, Carlsbad, CA) mixed with10 mM dithiotreitol (DTT ...
-
bioRxiv - Biochemistry 2022Quote: ... each with an N-terminal (His)6 tag from plasmids generated by GeneArt (ThermoFisher Scientific). For each purification ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged LCRIS_00661 and LCRIS_00558 genes with the appropriate restriction sites were ordered from Invitrogen and subcloned into a previously constructed S ...
-
bioRxiv - Neuroscience 2024Quote: ... After blocking supernatant samples from different groups and standards (recombinant human-TREM2-His; Life Technologies) were incubated for 2 h at room temperature (RT ...
-
bioRxiv - Microbiology 2024Quote: Dynabeads™ His-Tag Isolation and Pulldown magnetic bead solution (Thermo Fisher Scientific, United States) kit was used for the detection of the binding partner of OipA ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using an anti-His tag monoclonal rabbit antibody (Thermo Fisher Scientific) and GST monoclonal mouse antibody (own antibody) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We also subcloned this cassette into a pAc5.1/V5-His A plasmid (Invitrogen #V4110-20) by cutting the cassette out of pUASP-attb-Cry2-CTEV-mCherry using NotI and XbaI (NEB #R3189S and #R0145S ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% (v/v) heat-inactivated fetal bovine serum (HI-FBS; Thermo Fisher Scientific, 10099), penicillin (100 U/ml ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins were visualised using a primary anti-6xhis antibody (ArtNr: 11533923, Fisher Scientific), a HRP-coupled secondary antibody (ArtNr ...
-
bioRxiv - Immunology 2022Quote: ... containing a hexa-His tag was purified using HisPur Ni-NTA resin (Thermo Fisher Scientific). Expi cell supernatants were diluted with 1/3 volume of wash buffer (20 mM imidazole ...
-
bioRxiv - Neuroscience 2022Quote: ... using an Ion PGM Hi-Q View Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% (v/v) heat-inactivated fetal bovine serum (HI-FBS; Thermo Fisher Scientific, 10099), penicillin (100 U/ml) ...
-
bioRxiv - Molecular Biology 2023Quote: ... which were pre-loaded with 10 μL of Hi-Di™ formamide (ThermoFisher, Waltham, USA) and GeneScan™ -400HD ROX™ Size standard (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... This PCR fragment was TOPO cloned into pcDNA™3.1/V5-His backbone (Invitrogen, V81020). We used in vivo assembly cloning 40,41 for site directed mutagenesis to modify the nucleotide 1 bp upstream of the exon 49 splice junction to each of the alternative nucleotides (Supplementary table 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... The His-tagged dAsapPZA protein was expressed and purified following the manufacturer’s guidelines (Invitrogen, USA).
-
bioRxiv - Immunology 2023Quote: ... Glycan samples were run with a LIZ 600 DNA ladder in Hi-Di formamide (ThermoFisher) on an ABI 3500xL DNA sequencer and analyzed with GlycanAssure Data Acquisition Software v.1.0 ...
-
bioRxiv - Biophysics 2023Quote: ... His-tag purification was performed in Pierce disposable polypropylene 5mL disposable columns (Thermo Fisher Scientific) with a wash solution containing TNi 100/300/20 (100 mM Tris-HCl pH 7.4 ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... with the Ion PI™ Hi-Q™ Chef Kit (Thermo Fisher Scientific, Catalog # A27198) and Ion PI™ Chip Kit v3 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or F-vec were cultured in DMEM + 10% HI FBS with Zeocin (Thermo Fisher Scientific) selection ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved in heat-inactivated fetal-bovine serum (HI-FBS, ThermoFisher Gibco™ #12484028, USA) + 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved in heat-inactivated fetal-bovine serum (HI-FBS, ThermoFisher Gibco™ #12484028, USA) + 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific, MS, USA).
-
bioRxiv - Neuroscience 2023Quote: ... rattus Piccolo (2622-2937) DNA was cloned into vector pCDNA3.1-myc-his(C) vector (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... One microliter of sample was diluted in 9 ul Hi-Di™ Formamide (Applied Biosystems) containing 0.25 ul GeneScan™ 600 LIZ™ Size Standard ...
-
bioRxiv - Immunology 2024Quote: ... Amplified PCR fragments were inserted into the metallothionein promoter driven pMT-V5-His vector (Invitrogen). The generated vector was co-transfected with a pCoBlast blasticidin resistance vector with a ratio of 19:1 and cells were selected in blasticidin containing medium according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... in HepG2 medium (Advanced MEM minus L-Glutamine [Gibco] + 10% [v/v] HI-FBS [Gibco] + 1% [v/v] penicillin-streptomycin + 2 mM Glutamax [Gibco] and 0.1% [v/v] amphotericin B) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR product was mixed with Hi-DiTM mix (Thermo Fisher Applied BiosystemsTM, Carlsbad, USA) with GeneScantm LIZ dye Size standardtm (Thermo Fisher Applied BiosystemsTM ...
-
bioRxiv - Immunology 2024Quote: ... Blot was then incubated with 1:1000 dilution anti-his conjugated to HRP (Thermo Scientific) in 5% milk in 1xTBST (1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and the other was treated with 20 U of recombinant Escherichia coli RNase HI (Invitrogen) overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and passed through a 3 mL His-Pur Ni-NTA column (Thermo Scientific, catalog # 88226) according to manufacturer instruction ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-mouse PCSK9 (Invitrogen), mouse anti-mouse vinculin (Santa Cruz) ...
-
bioRxiv - Biophysics 2020Quote: HeLa and HEK293 cells were cultured at 37°C in an atmosphere of 5% CO2 in air in DMEM (Gibco, #10566024) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting HEK293 based stable cells were grown and maintained in adherent cell culture in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 9% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biophysics 2019Quote: HEK293 cells were grown in 1:1 Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 Ham with Glutamax+ (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (Alkali Scientific ...
-
bioRxiv - Biophysics 2019Quote: Human embryonic kidney cells 293 (HEK293-6E, NRC, Canada) were cultured in FreeStyle F17 expression medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... N-terminal FLAG-tagged human MCC (P23508-1) constructs (pCMV2B vector) were transfected into HEK293 cells and selected with G418 (Gibco #10131035). G418-resistant cells were grown ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the EBV-positive Burkitt lymphoma cell line Raji and the HEK293-based EBV producer cell lines were maintained in RPMI medium 1640 (Life Technologies). HEK293T cells were maintained in DMEM (Life Technologies) ...
-
bioRxiv - Biophysics 2021Quote: Human wild type ABCG2 or ABCG2 R184A containing an N-terminal Flag-tag was expressed in HEK293-EBNA (Thermo Fisher Scientific) cells as previously described19 ...
-
bioRxiv - Neuroscience 2022Quote: LC-MS/MS analyses were conducted using either a QExactive Plus Orbitrap (QE, RNase-digested polysomes) or a Velos Pro Elite Orbitrap (Elite, virus polysomes and HEK293 aggregates) mass spectrometer (Thermo Fisher) coupled online to a nanoAcquity UPLC system (Waters Corporation ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...