Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for 6 Methyl 2 Mercaptobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were -treated using 6 U of Turbo DNase (ThermoFisher, UK) at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Integrin alfa-6 (ITGA6) (1:1000) (MA5-16884, ThermoFisher Scientific) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... or with Cultrex SCQ (Bio-techne) coated 6 well plates (Nunc). Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... with specific primers on a QuantStudio 6 Flex instrument (Applied Biosystems). mRNA expression was normalized to the housekeeping gene Ppib for all samples ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis was conducted on a QuantStudio 6 (Thermo Scientific, USA) using TaqPath master mix (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and 1.8% sodium chloride (Fisher Scientific, ACS Cas.# 7647-14-6). After 20 minutes undisturbed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplified DNA was separated by using 6% TBE gels (Invitrogen) and imaged.
-
bioRxiv - Biophysics 2023Quote: ... using the QuantiStudio 6 Flex system (Applied Biosystems: Waltham, MA, USA). Gene expression was analyzed using the ΔΔCT method ...
-
bioRxiv - Genetics 2023Quote: ... along with 6 µL of PageRuler Plus Prestained Protein Ladder (ThermoFisher) as standard and electrophoresed at 170 V using the Mini Trans-Blot cell system (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... or 6 was then used to transform into stbl3 strain (Invitrogen) for further plasmid amplification.
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were loaded onto precast 6% TBE (Invitrogen, Fisher cat #EC62655BOX) or 10% TBE-Urea (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... for detection in QuantStudio 6 Pro cycler (Applied Biosystems Carlsbad, CA). Quantification of each transcript was normalized to the mouse 18S reference gene following the 2-ΔΔCt method ((Livak & Schmittgen ...
-
bioRxiv - Neuroscience 2024Quote: ... were coated with IL-6 capture antibody (ThermoFisher Scientific, MP5-20F3) and left overnight at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... and analysed using the Quant Studio 6 Flex system (Applied Biosystems). The real-time qPCR conditions were one hold at (95 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were grown for 6 passages in DMEM-HAM’s F12 (Gibco) supplemented with 5% (v/v ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.30 M di-benzo-18-crown-6-ether (Thermo Scientific) following published protocols66,67,79,80,110 ...
-
bioRxiv - Physiology 2024Quote: ... on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) with specific primers for each gene ...
-
bioRxiv - Neuroscience 2024Quote: ... or Quant Studio 6 Pro Real-Time PCR System (Applied Biosystems). TaqMan assay details are listed in Tab ...
-
bioRxiv - Cancer Biology 2024Quote: ... The desired DNA product was purified with 6% TBE gel (Invitrogen) and samples were sequenced on an Illumina HiSeq2000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was eluted 6 times in ultrapure water (Thermofisher, 10977) for maximum recovery ...
-
bioRxiv - Microbiology 2024Quote: ... Real-time qPCR was performed on QuantStudio 6 Pro (Applied Biosystems) using iTaq Universal SYBR Green Supermix (Biorad) ...
-
bioRxiv - Immunology 2024Quote: ... and real-time PCR system (Applied Biosystems 7500 QuantStudio 6 Pro). The Ct value of target genes obtained from each sample was normalized to housekeeping gene GAPDH and relative gene expression was quantified using 2-ΔΔct values.
-
bioRxiv - Microbiology 2024Quote: ... 6-5 cells were maintained in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% FetalPlex (Gemini Bio-Products) ...
-
bioRxiv - Immunology 2024Quote: ... and human IL-6 (Gibco, PeproTech, #200-06; 20 ng/mL). Prostaglandin E2 (PGE2 ...
-
bioRxiv - Genomics 2024Quote: ... a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, USA), with a 20 µl reaction mixture ...
-
bioRxiv - Genetics 2024Quote: ... and the homozygote variant iPSCs were grown in a feeder-free manner on Matrigel (Corning)-coated 6-well plates in Essential 8 (E8) medium (ThermoFisher Scientific). Media was changed daily ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eluted in 6 μl nuclease-free water (Ambion, cat# AM9937).
-
bioRxiv - Microbiology 2022Quote: ... and L plasmids at a ratio of 4:2:2:2:1 using Lipofectamine 2000 (ThermoFisher Scientific). Cells were transfected in 6 well plates and subsequently transferred to T25 flasks with HEp2 cells until cytopathic effect (CPE ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μM Rhod-2 AM (Thermo, R1244) and 2 μM Calcium green-1 AM (Life Technologies, C3011MP) was added to culture media and allowed to stain at 22 °C for 20 min prior to imaging (frozen Rhod-2 AM aliquots were used only when the DMSO suspension remained clear) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and FURA 2-AM (Fura-2-acetoxymethyl ester) from Invitrogen, CA ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 μM oligodT (dT25) and 2 μM random hexamers (Invitrogen) or 50nM stem-loop specific primers (for miRNA expression analysis) ...
-
bioRxiv - Bioengineering 2019Quote: ... 50 μM Gibco 2-Mercaptoethanol (2-ME) (Thermo Fisher, 21985023), 1x antibiotic-antimycotic (anti-anti ...
-
bioRxiv - Cell Biology 2021Quote: ... A fluorescent derivative of 2-deoxyglucose (2-NBDG, Invitrogen, N13195) was added at a final concentration of 20 µM for a further 30 min incubation at 37 °C ...
-
The structure of insulin granule core determines secretory capacity being reduced in type-2 diabetesbioRxiv - Physiology 2022Quote: ... Nucleobindin 2 and siRNA control #2 were purchased from ThermoFisher Scientific ...
-
SLC15A4 favors inflammasome function via mTORC1 signaling and autophagy restraint in dendritic cellsbioRxiv - Immunology 2022Quote: ... 2 mM L-Gln and 50 μM 2-mercaptoethanol (Invitrogen).
-
bioRxiv - Genetics 2022Quote: ... 2% B-27 and 1% N-2 supplements (Life Technologies) and supplements 20ng/ml BDNF ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were loaded with 2 μM Fura-2/AM (Invitrogen). Ratiometric Ca2+ imaging was performed at 340 and 380 nm in 0 or 2 mM Ca2+ Ringer’s solution using an IX81 microscope (Olympus ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µg of DNA and 2 µl Plus reagent (Invitrogen) were added to 1 ml serum-free media in a centrifuge tube ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.1 mM 2-mercaptoethanol (2-ME, Thermo Fisher Scientific)) supplemented with 4 ng/ml bFGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM L-glutamine and 2% penicillin/streptomycin (ThermoFisher Scientific). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were incubated with 2 μM Fura-2 (F1221, Invitrogen) at 37℃ for 30 min dispersed in Margo solution with 0.2‰ w/v Pluronic F-127 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µL FastAP Thermosensitive Alkaline Phosphatase (2 U) (Thermo Scientific) was added and the solution was incubated at 37°C for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... 2% B-27 and 1% of N-2 supplements (GIBCO), 1% L-glutamine ...
-
bioRxiv - Neuroscience 2024Quote: ... A 2 × 2 cm piece of Parafilm M (Fisher Scientific) was carefully placed onto the tissue so that the gene panel mix was evenly spread across the tissue and no bubbles were introduced between the tissue and the film ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 2% of 2-mercaptoethanol (Thermo scientific Cat. No: 125470100) and heated at 70°C for 10 mins before freezing them at – 80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% B-27 and 1% of N-2 supplements (GIBCO), 1% L-glutamine ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.1 mM 2-mercaptoethanol (2-ME, Thermo Fisher Scientific), supplemented with 100 ng/mL Activin A (Nacalai Tesque) ...