Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for 6 Methyl 2 Mercaptobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and cultivated for 6 days in RPMI1640/GlutaMax (ThermoFisher Scientific; 61870036) medium supplemented with 10 % FBS (EMD Millipore TMS-013-B ...
-
bioRxiv - Cancer Biology 2024Quote: ... in triplicates in 6-well plates using Lipofectamine RNAiMax reagent (Invitrogen) according to manufacturer’s instructions (Invitrogen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... or with Cultrex SCQ (Bio-techne) coated 6 well plates (Nunc). Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific). Standard cycling parameters were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following specialized instruments were used: QuantStudio Pro 6 (Applied Biosystems), HiSeq 3000 (Illumina) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... QuantStudio™ 6 flex Real-Time PCR System (Applied Biosystems: 4485691).
-
bioRxiv - Biophysics 2024Quote: ... oocytes were labeled with tetramethylrhodamine-6-maleimide (TMRM, Invitrogen or Abcam) at a final concentration of 25 µM and the cells were left in the dark on ice for 20 minutes ...
-
bioRxiv - Genomics 2024Quote: ... Reactions were loaded onto 6% TBE retardation gels (Thermo Fisher Scientific) and run in 0.5× Tris–borate–EDTA buffer for one hour ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was either eluted in 6 µl nuclease-free water (Invitrogen) and transformed into electrocompetent E ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were labeled with DAPI (4’,6-diamidino-phenylindole, Invitrogen) and subsequently mounted onto a glass slide and cover-slipped using an antifade mounting medium.
-
bioRxiv - Neuroscience 2023Quote: ... All experiments were carried out with QuantStudio 6 Flex (Applied Biosystems). SYBR was used as a reporter and ROX was used as a passive reference according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... Magnesium chloride (7791-18-6-500G) was obtained from ACROS Organics. 8 well-chambered cover glasses (Sterile ...
-
bioRxiv - Genomics 2024Quote: Agarose (Fisher Bioreagents/Thermo Fisher Scientific, cat. no. 9012-36-6)
-
bioRxiv - Cell Biology 2024Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotec ...
-
bioRxiv - Biochemistry 2024Quote: ... Purity was assessed using a 6% Tris-Borate-Urea gel (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... anti-Integrin alfa-6 (ITGA6) (1:1000) (MA5-16884, ThermoFisher Scientific) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... or with Cultrex SCQ (Bio-techne) coated 6 well plates (Nunc). Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco) ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis was conducted on a QuantStudio 6 (Thermo Scientific, USA) using TaqPath master mix (Thermo Scientific ...
-
bioRxiv - Genomics 2023Quote: ... with specific primers on a QuantStudio 6 Flex instrument (Applied Biosystems). mRNA expression was normalized to the housekeeping gene Ppib for all samples ...
-
bioRxiv - Microbiology 2023Quote: ... Electrophoresis was performed using pre-run 6% TBE gels (Invitrogen, MA) at 100-volts in 0.5x TBE buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... at 37°C for 6 minutes at which point DMEM (Gibco) was added ...
-
bioRxiv - Systems Biology 2022Quote: Nunc cell-culture treated 6-well plates (ThermoFisher scientific, Roskilde, Denmark) were coated with 1% Matrigel (Discovery Labware ...
-
bioRxiv - Neuroscience 2023Quote: ... interleukin 6 soluble receptor (Thermo Fisher Scientific, Waltham, USA, Cat # BMS214) and interleukin 13 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... qPCRs were performed using QuantStudio 6 system (Thermo Fisher Scientific, USA) and cycling conditions included 95°C for 10 min and 40 cycles consisting of denaturalization at 95°C for 15 seconds and annealing-extension at 60°C for 1 min ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative PCR was conducted on QuantStudio 6 (Thermo Fisher Scientific, USA) with SYBR Green (4309155 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and run in triplicates using a QuantStudio 6 system (ThermoFisher Scientific). A complete list of primers used in RT-qPCR can be found in the Supplementary Table 2.
-
bioRxiv - Plant Biology 2023Quote: ... and VIT1 was analyzed by qRT-PCR (QuantStudio 6, Thermo Fisher) using TaqMan Real-Time PCR Assays (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (10 ng/ml; Thermo Fisher Scientific, Waltham, MA, USA), IL-21 (50 ng/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Biophysics 2023Quote: ... 6 parts Leibovitz L-15 medium (Gibco, Thermo Fisher Scientific, Waltham), 3 parts autoclaved double-distilled water ...
-
bioRxiv - Biophysics 2023Quote: ... 6 parts Leibovitz L-15 medium (Gibco, Thermo Fisher Scientific, Waltham), 3 parts autoclaved double-distilled water ...
-
bioRxiv - Genetics 2023Quote: ... or 2.5mM MQAE ((N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (Thermo Fisher, E3101) diluted in 5% sucrose overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... a QuantStudio™ 6 Flex real-time PCR system (Applied Biosystems). Target transcript levels were normalized to those of the indicated reference genes ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μl 20× 6-carboxyfluorescein (FAM)-labeled Assay Mix (Applied Biosystems), and 9 μl of cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pulsed with 10-6 M of EdU (ThermoFisher, C10640) in cell culture media for 2h prior to fixation.
-
bioRxiv - Immunology 2023Quote: ... The following cytokines were measured: IL-6 (Invitrogen, #88-7064-88), IL-10 (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... 6 U MspI (Thermo Fisher, cat. no. ER0541, 10 U/µl) and 60 fg unmethylated lambda-DNA (Promega ...
-
bioRxiv - Immunology 2023Quote: ... All culture wells were supplemented with 6 mg/ml PI (Invitrogen) and were incubated at 37°C for 40 minutes ...
-
bioRxiv - Immunology 2023Quote: ... Bone marrow was seeded at 1x10^6 in RPMI (Gibco,11875119)+10%FBS containing 20ng/mL of recombinant GM-CSF (PreproTech ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a QuantStudioTM 6 Flex Real-Time PCR system (Applied Biosystems® ...
-
bioRxiv - Physiology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). In mouse samples ...
-
bioRxiv - Immunology 2023Quote: ... using a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems) (Glasgow) ...
-
bioRxiv - Cell Biology 2023Quote: ... on the QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems). The fold change was calculated using the 2^(−ΔΔCt ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems) using the default run program ...
-
bioRxiv - Genetics 2023Quote: ... Cells were cultured in 6 wells plates (ThermoFisher, Cat. No. 140675) with seeding density of 0,2×106 cells and were harvested for analysis after 48 hours of incubation.
-
bioRxiv - Developmental Biology 2023Quote: ... Transfections were conducted in 6-well format using Lipofectamine 3000 (ThermoFisher). 200 ng of reporter plasmid were co-transfected into 3T3-immortalized ...
-
bioRxiv - Cell Biology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The Tbp mRNA was used as a loading control ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions were run in a QuantStudio 6 Flex (Thermo Fisher) with a 95°C hold followed by 40 cycles of 95°C for 15s ...
-
bioRxiv - Physiology 2023Quote: ... Organs were then embedded in 6% agarose low melting gel (Invitrogen), and organ sections (100 μm ...