Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for 6 Bromo 3 N ethylamino 1 2 4 triazolo 4 3 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 1:200 N-2 supplements (Thermo Fisher Scientific, 17502048), 1:100 B-27 supplements without vitamin A (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Supernatant was mixed in a 4:1 ratio with 4-methylvaleric acid (Thermo Fisher catalogue number AAA1540506) in 6% v/v phosphoric acid and copper sulfate pentahydrate ...
-
bioRxiv - Immunology 2019Quote: ... DRGs inside vertebral column and the depilated hairy skin from PFA-perfused animals (6-12 weeks) were postfixed with 4% PFA for 1 hr or Zamboni fixative (Fisher Scientific) overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... then further cleared by centrifugation at 4°C and 25658 g for 1 h (Thermo Fisher Scientific, #A23-6×100 rotor). The supernatant was passed through a 0.22 µm filter (Corning #431097 ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 4 μM Mag-Fluo-4 (ThermoFisher Scientific) and 1 μM F-127 (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 25mM HEPES (2(−4-(2-hydroxyethyl)-1-piperanzinyl) ethansulfonacid) and supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, ThermoFisher Scientific), 10.000 U/mL (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary antibodies were applied for 2 hours in PBS/3% milk powder containing 1 μg/ml Hoechst-33342 (Invitrogen) or DAPI (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Activated/Cleaved Caspase-3 (1:1000; Cell Signalling Biology, CAT#: 9661S and Thermo Fisher Scientific, CAT#: 66470-2-IG), Nestin (1:1000 ...
-
bioRxiv - Genomics 2023Quote: ... and 100 μg/ml cycloheximide using Beckman Coulter UC tubes 9/16 x 3-1/2 (Fisher Scientific, NC9194790), and equilibrating overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 2 µL streptavidin-HRP (1:5,000; S911, Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... 25 μl/well of 60 mM water solution of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Thermo Fisher Scientific) were added ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... Target protein was coated overnight (O/N) at 4 °C on MaxiSorp™ 96-well plates (Nunc). ELISA-blocking buffer (PBS containing 0.5% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... Vero E6-TMPRSS2 cells were fixed with 4% paraformaldehyde and stained with anti-N (Invitrogen; MA1-7403). The number of fluorescent foci was measured using a Cytation 5 Cell Imaging Multimode Reader (BioTeK).
-
bioRxiv - Cell Biology 2020Quote: ... and 1.5 μg Random Primer Pd(N)6 (Invitrogen). RNA was denatured at 65°C for 2 min and then added to 40 U RNAse inhibitors (RNaseOUT-Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... was added prior to sonication on the lowest power setting (Output power: 3-4 Watts; 3x for 10 sec on, 30 sec off; Fisher Scientific Sonic Dismembrator Model 100). The samples were incubated with 150 units micrococcal nuclease (Cell Signaling ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were not allowed to reach confluency greater than 85% and were passaged every 3-4 days by dissociation into single-cell suspension using StemPro Accutase (Thermo Fisher Scientific, Waltham, MA, USA). When in single-cell suspension ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels with varying PEG-αMA wt% and DTT:MMP2-degradable crosslinker ratios (Table 1) were prepared with pH 8.0 N-2-hydroxyethylpiperaine-N-2-ethane sulfonic acid (HEPES; Thermo Fisher Scientific, Waltham, MA) as a solvent to allow base-catalyzed polymerization ...
-
bioRxiv - Pathology 2022Quote: ... as above and left to attach for 2 hours before adding bromodeoxyuridine / 5-bromo-2’-deoxyuridine (BrDU, Invitrogen B23151) to a final concentration of 75 µM and left to proliferate for 6 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Neuroscience 2020Quote: ... Third instar larvae were dissected with cold HL3 and immediately fixed with PFA (4%) and incubated overnight at 4 C with primary antibodies (rabbit anti-Dlg, 1:1000; anti-Brp 1:100, Life Technologies). Alexa-conjugated secondary antibodies were used for secondary staining (Jackson Laboratories 1:500) ...
-
bioRxiv - Immunology 2023Quote: ... Drosophila S2 cells were mixed with Ramos cells or B1-8hi B cells at a ratio of 1:4 (4×105 B cells and 1×105 S2 cells) followed by total RNA extraction with TRIzol reagent (Thermo Fisher), DNaseI digestion ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 2-4 seconds at a blotting force of 4 and plunge-frozen in liquid ethane using a MarkIV Vitrobot (Thermo Fisher Scientific). The chamber was maintained at 8 °C and 100% humidity during freezing ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatant was kept after spinning at 800 rcf for 2’ at +4°C and were incubated overnight at +4°C with 3µg of dedicated antibodies: Nr2f1 antibody (Thermo Fisher PA5-21611) and GFP antibody (Abcam ab13970 ...
-
bioRxiv - Immunology 2020Quote: ... 2-4 × 105 cell equivalents per well were loaded into a NuPAGE 4-12% Bis-Tris density gradient gel (Thermo Fisher Scientific) and ran at a constant 150V for 80 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded with the calcium indicator Fluo-4 by incubating in supplemented NB medium that contained 2 µM of Fluo-4 AM (Invitrogen, Carlsbad, CA), and Pluronic F-127 (0.04% ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Bioengineering 2024Quote: ... Qubit 3 (Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies ...