Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for Recombinant Human KLRD1 protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... which were pre-loaded with 10 μL of Hi-Di™ formamide (ThermoFisher, Waltham, USA) and GeneScan™ -400HD ROX™ Size standard (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR product was mixed with Hi-DiTM mix (Thermo Fisher Applied BiosystemsTM, Carlsbad, USA) with GeneScantm LIZ dye Size standardtm (Thermo Fisher Applied BiosystemsTM ...
-
bioRxiv - Molecular Biology 2024Quote: ... in HepG2 medium (Advanced MEM minus L-Glutamine [Gibco] + 10% [v/v] HI-FBS [Gibco] + 1% [v/v] penicillin-streptomycin + 2 mM Glutamax [Gibco] and 0.1% [v/v] amphotericin B) ...
-
bioRxiv - Microbiology 2024Quote: ... and passed through a 3 mL His-Pur Ni-NTA column (Thermo Scientific, catalog # 88226) according to manufacturer instruction ...
-
bioRxiv - Immunology 2024Quote: ... Blot was then incubated with 1:1000 dilution anti-his conjugated to HRP (Thermo Scientific) in 5% milk in 1xTBST (1 h ...
-
bioRxiv - Immunology 2024Quote: ... Amplified PCR fragments were inserted into the metallothionein promoter driven pMT-V5-His vector (Invitrogen). The generated vector was co-transfected with a pCoBlast blasticidin resistance vector with a ratio of 19:1 and cells were selected in blasticidin containing medium according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... The GFP-tagged and the knockout strains come from the commercial Yeast GFP clone collection (ThermoFisher Scientific). All cultures were grown in YPD medium (1% Yeast Extract ...
-
bioRxiv - Genetics 2021Quote: ... The ORF was Gateway cloned into a C-terminal GFP-tagged Gateway pcDNA-DEST47 vector (ThermoFisher Scientific), sequence verified ...
-
bioRxiv - Molecular Biology 2021Quote: ... HA-tagged hamster SCAP was prepared by subcloning PCR products into the pcDNA5/FRT/TO vector (Invitrogen). DsRed-ER plasmids were purchased from Addgene (#55836) ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μg (otherwise noted) of terminally tagged and unmodified σ1R plasmid was transfected using lipofectamine 2000 (Invitrogen) for HEK 293T Δσ1R cells in a 10 cm plate ...
-
bioRxiv - Neuroscience 2019Quote: ... GFP-Msp300KASH tagged OSN nuclei were pulled down using a Chicken anti-GFP antibody (Invitrogen #PA1-9533) bound to magnetic Dynabeads™ Protein G (Invitrogen #10003D) ...
-
bioRxiv - Microbiology 2019Quote: ... coli MG1655 cells expressing tagged HupA-GFP with 2 µg/ml of FM4-64 dye (Invitrogen, USA) and incubating for 5 min at 37°C with shaking at 180 rpm ...
-
bioRxiv - Cancer Biology 2019Quote: ... EdU was tagged with Alexa Fluor 647 picolyl azide through click reaction (Click-iT chemistry, ThermoFisher, C10640). The cells were blocked with blocking buffer at least overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Pierce anti-HA beads for immunoprecipitation of HA-tagged GAPDH was purchased from Thermo Fisher (Cat. # 88836) Rabbit polyclonal antibody (Cat ...
-
bioRxiv - Physiology 2021Quote: ... incubated with different primary Abs and revealed by appropriate Alexa-Fluor-tagged secondary Abs (Thermo Fisher Scientific). Cells were analyzed by using a Nikon Ti Eclipse inverted microscope with A1 scanning confocal microscope at the Confocal and Specialized Microscopy Shared Resource (CSMSR) ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated with different primary Abs and revealed by appropriate Alexa-Fluor-tagged secondary Abs (Thermo Fisher Scientific). Slides were mounted in Fluoromount-G (Southernbiotech ...
-
bioRxiv - Neuroscience 2020Quote: ... The fluorescent-tagged secondary antibodies Alexa Fluor 488 and Alexa Fluor 555 (1:500, Thermo Fisher Scientific) were used for detection ...
-
bioRxiv - Cell Biology 2021Quote: cDNAs in pENTR or pDONR were transferred into tagged mammalian expression vectors using Gateway® recombination (Invitrogen): pCAG-DEST-EGFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were transfected with 200 ng of Flag-tagged FOXQ1 using Lipofectamine 2000 (Thermo Fisher, Waltham, USA). After 24 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... Species-specific secondary antibodies tagged with Alexa Fluor corresponding to 568 nm emission spectra (1:1,000, Thermofisher) was used for immunofluorescence ...
-
bioRxiv - Microbiology 2022Quote: ... HNRNPUL1 and MECR were recombined into V5-tagged mammalian expression constructs by Gateway cloning into pcDNA6.2 (Invitrogen) and pLX304 (Addgene 25890) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg of Flag-Strep-Strep-(FSS)-tagged LRRK2RCKW cDNA and Lipofectamine 2000 reagent (ThermoFisher Scientific, USA) were used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... while non-Avi tagged antigens were biotinylated chemically using EZ-Link Sulfo-NHS-Biotin (Thermo Fisher, A39256). VH and VL sequences of SARS-CoV-2 control antibodies (COV2-2196 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cross-absorbed secondary antibodies tagged with Alexa-fluorophores were diluted in blocking buffer (1:400, Invitrogen, Switzerland) and applied for 30 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 and MS2-tagged HEK293:24xMS2-NEAT1 cells were cultured in Dulbecco’s modified eagle’s medium (DMEM, Gibco) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were then transfected with Halo-tagged gene constructs using Lipofectamine LTX (Thermo Fisher Scientific, MA, USA). After 48 hours ...
-
bioRxiv - Immunology 2024Quote: ... FLAG-tagged constructs were PCR amplified with Gateway adapters and cloned into pDONR221 using BP Clonase (Invitrogen). Hoil1 and Hoip mutations and deletions were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2024Quote: ... inserts were then subcloned into pCS2+ N HA tagged vectors that had been converted into Gateway (Invitrogen) destination vectors ...
-
bioRxiv - Cell Biology 2024Quote: HEK cells and zebrafish samples were tagged with TMT10plex™ Isobaric Label Reagent Set (Thermo Scientific, #90111), and fibroblast cells with TMTpro™16plex Isobaric Labels (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... IPs of FLAG-tagged PRRC2B and PRRC2B fragments were performed using anti-DYKDDDDK Magnetic agarose (ThermoFisher Scientific). Beads were mixed with 70 μl of SDS loading buffer (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with fluorescence-tagged secondary antibodies (Molecular Probes Alexa series, all 1:400 in PBS) for 1h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were incubated with Alexa Fluor 555 tagged donkey-α-rabbit secondary antibody (1:1000; Molecular Probes) and Alexa Fluor 488-tagged donkey-α-goat secondary antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Biotin-tagged DNA nicks were visualized using Alexa488-or Alexa647-conjugated streptavidin (Molecular Probes, diluted 1/1000) during the incubation with the secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... The supernatant fraction containing the GST-tagged constructs were loaded onto Protino Glutathione Agarose 4B (Fisher Scientific) beads and impurities were removed by washing with TBS ...
-
bioRxiv - Cell Biology 2023Quote: MDA-MB-231 clones H2 and C10 carrying endogenously tagged HiBiT-cIAP1 were generated by Thermo Fisher and were used for compound screens ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were next incubated with AlexaFluor-555 tagged donkey-α-rabbit secondary antibody (1:1000, Molecular Probes) for one hour and imaged with a Nikon Eclipse 90i or a Nikon Eclipse Ti2 inverted microscope ...
-
bioRxiv - Neuroscience 2023Quote: ... The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... His8-tagged TGM2 was first pulled down by BSA-blocked Ni2+-NTA agarose beads (Thermo Fisher Scientific). Next ...
-
bioRxiv - Cancer Biology 2024Quote: MOLT-4 cells expressing HiBiT-tagged CDK9 were cultured in RPMI 1640 medium (Thermo Fisher Scientific, 11875093) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...