Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Recombinant Human KLRD1 protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μL of 40U/μL of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, #10777-019), and 0.5μL 200 U/μL SuperScript III reverse transcriptase ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng/mL recombinant RSPO1 (Thermo Fisher Scientific, cat# 120-38-500UG), and 100 ng/ml recombinant noggin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Neuroscience 2021Quote: ... The presence of secreted Fc Fusion protein in the medium was confirmed by immunoblotting with goat anti-human IgG antibody (Invitrogen, A-21433, 1:500).
-
bioRxiv - Genomics 2020Quote: For Hi-C experiments knockdown of CLAMP was validated using the Western Breeze kit (Invitrogen). Antibodies used for detection were a previously described custom rabbit antiCLAMP (1:1,000 ...
-
bioRxiv - Genomics 2020Quote: The psep-1::his-58::eGFP transgene was generated using three-site Gateway cloning (Invitrogen) in the MosSCI compatible vector pCFJ150 ...