Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 OXABICYCLO 3.2.1 OCT 3 EN 7 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Neuroscience 2023Quote: For lightsheet experiments 6-7 dpf fish are placed in 2.2% low-melting point agarose (Thermofisher) in a chamber optimized for our lightsheet microscope.
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed using the QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems). The setting of the cycles used was the default for comparative Ct studies ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in one well of 6 well plates were collected in ice-cold PBS (Gibco) and lysed in 200 µL lysis buffer (50 mM Tris-HCl pH 7.0 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), was added to the media of the IL-6 dependent myeloma cell lines INA-6 ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 were seeded in 6-well plates (Falcon) with one glass coverslip (Fisher Scientific) per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2020Quote: ... Frozen 4% PFA fixed OCT (Fisher Scientific, Hampton, NH) sections were placed on slides ...
-
Reconstitution of prospermatogonial specification in vitro from human induced pluripotent stem cellsbioRxiv - Developmental Biology 2020Quote: ... The tissues were embedded in OCT compound (Fisher Scientific), frozen and sectioned at a thickness of 10 µm at -20 °C using a cryostat (Leica ...
-
bioRxiv - Neuroscience 2020Quote: ... The brains were embedded in OCT compound (Thermo Scientific) and cut into 50-μm sections using a cryostat (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... Brains were embedded in OCT Compound (Thermo Fisher Scientific) and sliced on the cryostat at 20μm thickness ...
-
bioRxiv - Neuroscience 2022Quote: ... and octanol (OCT, Fisher Scientific, Cat. No: SALP564726, undiluted). Odorants were loaded into the caps of 0.6 mL tubes (EMSCO/Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... Brains were immersed in HistoPrep OCT (Thermo Fisher Scientific) for 10 minutes before flash freezing and stored in the −80°C freezer until ready for slicing ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were then embedded in OCT (Thermo Fisher scientific) and sectioned into 20 μm on a cryostat sectioning machine (Thermo Fisher scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and frozen in Tissue-Plus OCT compound (Thermo Scientific). Frozen brains were sliced into 40μm-thick free-floating coronal sections using a cryostat (Leica) ...
-
bioRxiv - Neuroscience 2021Quote: ... and then frozen in OCT (ThermoFisher #23-730-571) and stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Brains were then embedded in OCT (Thermo Fisher scientific) and sectioned into 20 μm on a cryostat sectioning machine (Thermo Fisher scientific ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... the pancreata were embedded in OCT compound (Thermo Scientific) and flash-frozen in isopentane chilled on liquid nitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... the brains were embedded in OCT medium (Thermo Fisher) and sectioned at 8 μm thickness using a CM3050S cryostat (Leica Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then embedded in OCT (Thermo Fisher Scientific), sectioned at 14 μm using a Leica cryostat ...
-
bioRxiv - Neuroscience 2023Quote: ... and octanol (OCT, Fisher Scientific, Cat. No: SALP564726, undiluted). Odorants were loaded into the caps of 0.6 mL tubes (EMSCO/Fisher ...
-
bioRxiv - Immunology 2023Quote: ... Intestines were then positioned in OCT (Fisher Scientific 4585) in base molds (Fisher Scientific 22-363-552 ...
-
bioRxiv - Neuroscience 2024Quote: ... Brains were then frozen in OCT compound (Fisher Scientific) and stored at −80°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... and ran in duplicate using the QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2023Quote: ... Hepa 1-6 and HuH-7 were grown in Dulbecco’s modified Eagle’s medium–high glucose (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein thermal stability was measured by differential scanning fluorimetry using a QuantStudio Pro 6/7 (Applied Biosystems). Protein was brought to a concentration of 10 uM with 5x Sypro Orange dye in a final volume of 20 µL in 20 mM NaPi ...
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocking buffer was replaced after one hour with 7 µg/mL mouse anti-occludin antibody (cat# 33-1500, Invitrogen) in PBS with 5% goat serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... One 6-well plate per reporter to the tested was transfected using RNAiMax transfection reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... MDCK II cells were seeded in tandem one set on a 6 well plate (Thermofisher, 140675) at 28,000 cell density (for qPCR analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... The pellet was resuspended 3 times using 7 mL Wheaton Dounce tissue grinder (Fisher Scientific) and centrifuged at 12,000 rpm at 4°C for 30 minutes (Sorvall SS-34 centrifuge rotor) ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...