Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 1 3 Methoxyphenyl 6 7 dimethyl 6 azoniabicyclo 3.2.1 octane bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured for 6-7 days prior to detachment with 0.25% trypsin-EDTA (Life Technologies, 25200-056) for use in experiments ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were cultured for 6-7 days prior to detachment with 0.25% trypsin-EDTA (Life Technologies, 25200-056) for use in experiments.
-
bioRxiv - Immunology 2024Quote: ... B-7-6 was produced in our own laboratory and was directly conjugated to DyLight (Pierce/Thermo Scientific) fluorochromes ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2022Quote: ... the metabolic activity of viable cells was tested by a colorimetric dimethyl-thiazole-diphenyltetrazolium bromide (MTT) assay (cat. no. M6494, Invitrogen). Briefly ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200 ng of nLYN-mCherry and 500 ng of iLID plasmid were mixed with 2.1 ul (1 to 3 ratio) of Fugene 6 in 125 ul of Opti-MEM medium (Thermofisher Scientific). After 10 minutes incubation at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/mL TPO and 40 ng/mL IL-3 from day 1 to day 6 with a media refresh every 2 days (all cytokines from Thermofisher). On day 8 ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were replated at a 1:3 ratio on Geltrex™-coated 6-well plates (Thermo Fisher Scientific, Cat# A1413201) and maintained in NE medium ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 μg of mouse Cot-1 DNA (Thermo Fisher Scientific), and 10 μg of sheared salmon-sperm DNA (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Bioengineering 2023Quote: Hepa 1-6 cells (ATCC) were cultured in DMEM (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4′-6-diamidino-2-phenylindole (Life Technologies, 1:500 dilution) and HCS Cell Mask Deep Orange (Life Technologies ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were plated at 650,000 cells per well of a 6 well plate and infected with 6 dilutions from a 10-fold dilution series in 1% FBS (Gibco, MA)/1X non-essential amino acids (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... heated for 3 mins at 90C and separated on a 6% denaturing PAGE gel (Invitrogen). The RNA was then transferred to a HyBond-N+ nylon membrane (GE Life Sciences ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 μg of pre-aliquoted Tandem Mass Tag 6-plex (TMT-6, Thermo Scientific) was resuspended in 20 μL anhydrous acetonitrile ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasma IL-6 was measured by immunoassay (ProQuantum Human IL-6 Immunoassay Kit, ThermoFisher) and run on the ABI 7300 (Applied Biosystems ...
-
bioRxiv - Bioengineering 2023Quote: FsC[Fe3+] was labelled by 6-carboxyfluorescein (6-FAM) (Thermo Fisher Scientific, Waltham, USA) to indicate the targeting of FsC[Fe3+] to C ...
-
bioRxiv - Microbiology 2021Quote: ... 6% Sodium bicarbonate solution (Gibco), 8% Fetal bovine serum (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... TNF and IL-6 (Invitrogen) ELISA kits were used according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... or QuantStudio 6 (Applied Biosystems) thermocycler ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Microbiology 2021Quote: ... 6 μg/ml geneticin (Invitrogen) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... TRAF-6 (Invitrogen-PA5-29622), and Cyclin D1 (Invitrogen-AHF0082) ...
-
bioRxiv - Molecular Biology 2020Quote: ... IL-6 (Invitrogen, California, USA), TNF-α (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM L-glutamine (Gibco), 0.1 mM MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 6 well plates (Biolite, Thermofisher) or 96 well plates (Biolite ...
-
bioRxiv - Microbiology 2020Quote: ... 6 U Turbo DNase (Invitrogen) and 100 U DNase I (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM L-glutamine (Gibco), 100 mg/ml penicillin and streptomycin (P/S ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM L-glutamine (Gibco), 100 mg/ml penicillin and streptomycin (P/S ...
-
bioRxiv - Cancer Biology 2022Quote: ... or QuantStudio 6 (Applied Biosystems) thermocycler ...
-
bioRxiv - Cell Biology 2022Quote: ... on QuantStudio 6 (Life Technologies). Primers were pre-validated for high efficiency and internally tested not to vary upon OP9 differentiation ...
-
bioRxiv - Microbiology 2022Quote: ... 6 days for blasticidin (Gibco), zeocin (Invivogen ...
-
bioRxiv - Microbiology 2023Quote: ... 6 mM L-glutamine (Gibco), and 100 mg/ml penicillin and streptomycin (P/S ...