Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 1 3 Methoxyphenyl 6 7 dimethyl 6 azoniabicyclo 3.2.1 octane bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: For MQAE (N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (ThermoFisher) assays U87 cells were seeded into dark 96-well microtiter flat-bottom plates at 4 × 104 cells·well-1 in 100 µL volumes DMEM media supplemented with 10% FBS and 1% Penicillin/Streptomycin and incubated overnight at 37°C ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Genetics 2023Quote: ... or 2.5mM MQAE ((N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (Thermo Fisher, E3101) diluted in 5% sucrose overnight ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... at 6-7 days in vitro (DIV) or Lipofectamine 2000 (Thermofisher) 24/72 hours before the experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... iPSCs were passaged every 6-7 days with Versene (Life Technologies) at a 1:12 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... DCFH-DA (6-carboxy-2′,7′- dichlorodihydrofluorescein diacetate) was from Invitrogen. DMSO and Evans Blue Dye were purchased from Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... and ran on QuantStudioTM 6 Flex Real-Time PCR System using QuantStudioTM 6 and 7 Flex Real-Time PCR software v1.0 (Applied Biosystems). Relative gene expression levels were quantified using β-actin or human TBP as housekeeping genes ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were passaged every 6-7 days applying 0.5 mM EDTA (Thermofisher) in sterile Dulbecco’s Phosphate Buffered Saline (DPBS ...
-
bioRxiv - Physiology 2024Quote: ... and the QuantStudio 6 and 7 Real-Time PCR System (Applied Biosystems), using the default protocol for comparative Ct studies ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Hepa 1-6 and HuH-7 were grown in Dulbecco’s modified Eagle’s medium–high glucose (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS) ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... hiPSC at day 6-7 after passaging were treated with a 1:1 mixture of TrypLE Select (Life Technologies) and 0.5 mM EDTA/phosphate-buffered saline (PBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Slices were finally incubated for 3-6 minutes with DAPI (1:10 000, Invitrogen) diluted in PBS and mounted on Polysine® Slides stored at 4°C until imaging.
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reactions were run on the QuantStudio 6 or 7 (ThermoFisher Scientific, Waltham, MA) using the qPCR reaction settings as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Physiology 2020Quote: ... interleukin 6 (IL-6; Invitrogen, Carlsbad, CA), plasminogen activator inhibitor 1 (PAI-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 wells of a 6-well plate of mESC (corresponding to 6*10^6 cells approximately) were resuspended in 1 mL Trizol (Invitrogen,15596018) vortexed two times for 30 seconds and incubated 5 minutes at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Larval zebrafish at 6-7 dpf were paralyzed by immersion in 1 mg/ml alpha-bungarotoxin solution (Invitrogen) dissolved in external solution (in mM ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Genetics 2024Quote: ... All cells were treated with 6 µg/mL ethidium bromide (EtBr) and 0.05 µg/mL KaryoMAX (Gibco; Cat #: 15212012) prior to harvest ...
-
bioRxiv - Genetics 2024Quote: Cell pellets (1 x 10^5 – 3 x 10^6) were washed with PBS (Gibco), resuspended in RLB (10 mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Immunology 2022Quote: ... Design and Analysis QuantStudio 6/7 Pro Systems Software (Thermo Fisher Scientific, Version 2.5.0) was used to identify amplification of genes and calculate fold change from Cq values ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Biophysics 2024Quote: ... USA) dissolved in ethanol or 1μL 2.5mg/mL N,N-Dimethyl-6-dodecanoyl-2-naphthylamine (LAURDAN; Thermo Fisher, USA) dissolved in dimethyl sulfoxide to label the EVs ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dimethyl sulfoxide (DMSO) and 7-hydroxycoumarin were purchased from Fisher Scientific. Hydroxybupropion-d6 was purchased from Cambridge Isotope Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... Harvested equine explants were allowed to recover in 6-well plates for 3-7 days in the following control medium: DMEM/F12 medium (11330, Thermo Fisher Scientific, Waltham, MA), 10% fetal bovine serum (Seradigm 1500-500 ...
-
bioRxiv - Genomics 2024Quote: ... HAECs at low passage (passage 3-6) were treated prior to harvest every 2 days for 7 days with either 10 ng/mL TGFB2 (ThermoFisher Scientific, cat. no. 302B2002CF), IL1B (ThermoFisher Scientific ...