Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and plates were blocked with 3% non-fat milk (Life Technologies) diluted in PBS containing 0.01% Tween-20 (PBST ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR reactions were run on a QuantStudio 3 (Applied Biosystems). The data were normalized using a standard curve from gDNA extracted from purified EBs.
-
bioRxiv - Microbiology 2023Quote: ... The first method was staining with DiIC12(3) dye (Thermo Fisher). Five milliliters of overnight B ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are indicated in Appendix Table 2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Fisherbrand™ regenerated cellulose dialysis tubing (12-14 kDa, 21-152-14, Fisher Scientific), bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD45R (Thermofisher, 14-0452-82), MHCII (Thermofisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Biotin-14-dATP (Life Technologies) was incorporated for 1 h at 37oC with rotation ...
-
bioRxiv - Neuroscience 2021Quote: ... Ki67 (Invitrogen, 14-5698-082) 1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Ki67 (Invitrogen, 14-5698-082) 1:500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ki67 (Thermofisher, 14-5698-82), CD8 (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... MHCII (Thermofisher, 14-5321-81), αSMA (ProteinTech ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... SYTO 14 green (Invitrogen; S7576), Concanavalin A/Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... EOMES+ (ThermoFisher-14-4877-82) and NKG2D+ (Novus-5c6 ...
-
bioRxiv - Microbiology 2021Quote: ... Mouse IgG1κ isotype control was purchased from Invitrogen (ThermoFisher, Cat# 14-4714-85). Fatty acid-free BSA was from Sigma (St ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ki67 (Invitrogen, 14-5698-82), WT1 (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD62L (MEL-14, Invitrogen), anti-CD11b (M1/70 ...
-
bioRxiv - Biophysics 2022Quote: ... and biotin-14-dATP (Invitrogen), each added to a final concentration of 50 µM in a reaction with ~6 µg DNA and 15 U Klenow polymerase ...
-
bioRxiv - Immunology 2022Quote: ... Ki67 (14-5698-82, Invitrogen), KRT5 (ab52635 ...
-
bioRxiv - Physiology 2022Quote: ... or Kir2.1 (S112B-14, Invitrogen) in 1% BSA/PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... -CD3e (ThermoFisher; 14-0031-82), -PD-L1 (BioLegend ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotin-14-dATP (Life Technologies) was incorporated for 1h at 37°C with rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... PDGFRα (Invitrogen, #14-1401-82) were diluted 1:200 in PBS for overnight at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Brachyury (Invitrogen 14-9771-80); Nestin (EMD Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... LGALS3 (Invitrogen, 14-5301-82), and HTII-280 (Terrace Biotech) ...
-
bioRxiv - Immunology 2020Quote: ... Rabbit mAb (SinoBiological) and IFITM3 was subsequently performed using eBioscience Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) followed by surface antigen staining.
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed 3 times with blocking solution followed by incubation with Alexa 488-conjugated goat anti-rabbit IgG (H+L) (Life Technologies:# A-11034; 1:5000) for 2.5 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... kidneys were then washed in 1% Triton X-100 in PBS 3 x 10 minutes at room temperature and incubated with Alexa Fluor 488 conjugated goat anti-rabbit IgG (Thermo Fisher: A-11008, 1:250) and 0.5ug/mL DAPI overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Mtb-SC and Mtb-AG-infected rabbit lungs (n=3 per group per time point) was isolated using TRIzol reagent (Life Technologies, Grand Island, NY, USA) as described earlier (5 ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were washed and incubated 3 h with secondary antibodies: Alexa Fluor 488 (Anti-rabbit, 1:1000, Invitrogen, Themo Fisher Scientific, Slangerup Denmark, #A11008, AB_143165), Cy3 (monoclonal donkey anti-rabbit 1:600 ...
-
bioRxiv - Cell Biology 2022Quote: ... with <0.9% rabbit brain tissue contaminant) and another tube with human recombinant Thromboplastin (Thermo fisher scientific). Next to remove cells ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-EEA1 (mAb MA5-31575, Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... HuCD mouse mAb (1:20; Invitrogen), TBR1 rabbit pAb (1:300 ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... PGK1 mouse mAb (22C5D8) from Invitrogen. GFP Living Colors A.v ...
-
ALS iPSC-derived microglia and motor neurons respond to astrocyte-targeted IL-10 and CCL2 modulationbioRxiv - Neuroscience 2023Quote: ... mouse anti-TGFβ (ThermoFisher, #MAB-16949), mouse anti-NFkB p65 (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... PGK1 mouse mAb (22C5D8) from Invitrogen. FLAG mouse clone M2 (F1804 ...
-
bioRxiv - Immunology 2024Quote: ... FITC-IgG+ and biotin-blocked Per-CP streptavidin negative cells from this gate was sorted into wells containing 3 µl chilled lysis buffer (0.5X Gibco PBS, 3 U/µl RNaseOUT and 10 mM DTT) for a subsequent reverse-transcriptase reaction in a 96 well PCR plate ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Kcnj10 (Kir4.1) (1:400, APC-035; Alomone labs)rat anti-Lgals3 (1:200, 14-5301-82; ThermoFisher); rabbit anti-Lxn (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Ki67 (1:500, rabbit polyclonal, ab15580 Abcam or 1:500, rat monoclonal, 14-5698-82 Thermo Fisher Scientific); anti-RFP (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocking Buffer (E-cadherin mAb #14472 Cell Signaling Technology 1:1000, β-catenin mAb #8480 Cell Signaling Technology 1:1000, Occludin mAb #33-1500 Invitrogen 1:500). On the next day the membranes were washed three times for tenminutes in Tris-buffered saline + 0.05% Tween (#91414 ...
-
bioRxiv - Plant Biology 2020Quote: ... and biotinylated using the Biotin 3′ End DNA Labeling Kit (Thermo Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 mg/ml of type I collagen (Thermo Fisher Scientific, Rochester, NY), DMEM medium ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 more times and embedded in Prolong Antifade Gold (Thermo Scientific). Stainings with Rab5 and Rab7 antibody (Cell Signalling ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclear counter-staining was performed with Hoechst 3(3342 (NucBlue, Thermo Fisher).
-
bioRxiv - Cell Biology 2020Quote: ... 1% [w/w] P/S [Gibco] and 1 % [w/w] Glutamax [Gibco]) supplemented with 1 μM TO-PRO®-3 (Thermo Fisher Scientific). After 16 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were loaded onto NuPAGE 3-8 % Tris-Acetate gradient gels (ThermoFisher) prior to transfer onto PVDF membrane ...