Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Protein lysates were resolved on 3-8% (Thermo Fisher Scientific EA0375BOX) or 4-12% gradient SDS-PAGE gels (Thermo Fisher Scientific NP0321BOX) ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitative PCR was performed with the QuantStudio 3 system (ThermoFisher Scientific), using PowerUpTM SYBRTM Green Mastermix (AppliedBiosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Cancer Biology 2023Quote: ... Subsequent qPCR was performed on a Quant Studio 3 instrument (ThermoFisher), utilizing gene-specific PCR primers mixed with Power SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2023Quote: ... and scanning were performed using the 3¢ IVT Express Kit (Affymetrix) and GeneChip Arabidopsis Genome ATH1 Array (Affymetrix ...
-
bioRxiv - Neuroscience 2023Quote: ... while batch 3 was labeled with TMTPro (ThermoFisher A44520 – Lot# VH311511) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... at 3 days in vitro (DIV) using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s protocol as shown previously (Kim & Ziff ...
-
bioRxiv - Physiology 2023Quote: ... the cells were fixed in 3% paraformaldehyde (Fisher Scientific #T353- 500) in 1xPBS for 15 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Biophysics 2023Quote: ... or 3 µM SytoxBlue Cell Death stain (Thermos Fisher Scientific, S34857). Pyroptosis kinetics measurements were performed by acquiring images before pyroptosis induction and afterwards with intervals of 15 min at a Spinning disk confocal microscope (CellVoyagerTM CQ1 Benchtop High ...
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were then washed 3 × with prewarmed MEM (Gibco Cat#51200038) in the form of 75% media exchanges ...
-
bioRxiv - Molecular Biology 2023Quote: ... For library generation the Collibri 3’-mRNA Prep Kit (ThermoFisher, A38110024) was used ...
-
bioRxiv - Genetics 2023Quote: ... Mixtures of 3 RNAi directed against ATR (HSS100876, HSS100877, HSS100878, Invitrogen), CHK1 (HSS101854 ...
-
bioRxiv - Immunology 2023Quote: ... counted using a Countess 3 cell counter (Thermo Fisher Scientific #A49865) and concentration was adjusted to 3,000-5,000 nuclei/µL.
-
bioRxiv - Genomics 2023Quote: ... The library was quantified with a Qubit 3 fluorometer (Invitrogen Q33216) and its size was assessed with the Agilent Femto Pulse ...
-
bioRxiv - Molecular Biology 2023Quote: ... The qPCR reaction was run on a QuantStudio 3 (Applied Biosystems) and data analysed with Design and Analysis 2.7.0 software (Applied Biosystems).
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed with QuantStudio 3 Detection System (Thermo Fisher Scientific) in a 20 μL reaction mixture containing SYBR Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Cell Biology 2023Quote: ... we added cellEvent™ Caspase-3 Green detection reagent (C10423, Invitrogen) at 2 µM.
-
bioRxiv - Cell Biology 2023Quote: ... 9 was performed using a QuantStudio™ 3 (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific), as described previously (68) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were blocked with PBTX containing 3% normal goat serum (Invitrogen) for 1 h at RT and incubated with primary antibody in PBTX with 3% normal goat serum for 3 h at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and plates were blocked with 3% non-fat milk (Life Technologies) diluted in PBS containing 0.01% Tween-20 (PBST ...
-
bioRxiv - Biochemistry 2023Quote: ... Cas9 was diluted to 3 µM with Opti-Mem (ThermoFisher Scientific) and sgRNAs were diluted to 3 µM with TE buffer (Synthego Inc) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pH 8.3) and 3 µL of SYBR safe (Thermo Fisher Scientific). Gels were run at 70 V for approximately 2-3 hrs at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... and run on the QuantStudio 3 system (Applied Biosystems, Waltham, Massachusetts). Human 18S rRNA was used as the housekeeping gene for normalization ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TO-PRO™-3 Iodide (Invitrogen, UK) for 15 min and mounted using ProLong Glass Antifade Mountant (Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: ... Assays were run on the QuantStudio 3 PCR system (Applied Biosystems). To ensure results included all Kcnq2 and Kcnq3 splice isoforms (Pan et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... A405 measurements were taken in a spectrophotometer (BioMate 3, Thermo Fisher) for 5 min with 1 min intervals ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was labeled with ToPro-3 (1:5000; Invitrogen, Cat #T3605) in 0.3% PBST for 30 min at RT ...
-
bioRxiv - Physiology 2024Quote: ... and on a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The primers were all purchased from Millipore Sigma with sequences listed as below ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... column (Betasil C18, 100 × 2.1 mm, 3 µm particle; Thermo Scientific) was washed with 100 mL of Solvent B (MeOH ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Microbiology 2024Quote: ... or a QuantStudio 3 (Thermo Fisher Scientific, Inc., Waltham, MA, U.S.A.) with two primers and probes consisting of the forward primer (5’-TGC TCA TGG TAT CAA TCT TAT CG −3’) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were detected using a QuantStudio 3 (Thermo Fisher Scientific) qPCR machine ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were fixed in 3% paraformaldehyde (PFA; #043368.9M, Thermo Fisher Scientific) for 10 min at room temperature (RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cell Biology 2024Quote: ... organoids were washed 3 times with ice-cold PBS (Gibco, #14190250) and kept on ice for the entire isolation procedure ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR reactions were run on a QuantStudio 3 (Applied Biosystems). The data were normalized using a standard curve from gDNA extracted from purified EBs.
-
bioRxiv - Immunology 2024Quote: ... were coated with 3 µg ml-1 of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...
-
bioRxiv - Genetics 2023Quote: ... cells were counted with Countess 3 Automated Cell Counter (Thermo Fisher) and around 100,000 cells were allotted into a fresh 1.5 mL tube and centrifuged at 500 g for 10 min at 4℃ ...
-
bioRxiv - Microbiology 2023Quote: ... The first method was staining with DiIC12(3) dye (Thermo Fisher). Five milliliters of overnight B ...