Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Hsc70cb cDNA was amplified using PCR and inserted into the pProEX-HTA protein expression vector using 5’ SacI and 3’ SpeI restriction enzyme sites (Invitrogen, Carlsbad, CA, USA). Two Drosophila NBD constructs (with or without a stop codon ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked for 1 hour in 5 % normal donkey serum in 3% PBST and then incubated in chicken anti-GFP (Invitrogen, A10262, 1:1000) overnight at 4°C ...
-
bioRxiv - Pathology 2021Quote: ... or LGALS1 siRNA (Eurofins Genomics; Ebersberg, Germany) with the sense sequence 5’-[UUGCUGUUGCACACGAUG-GUGUUGG]-3’ the following day using Lipofectamine® RNAiMAX (Thermo Fisher Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted RNA from each positive sample was used as template to synthesize cDNA using primer MBTuni-12 (5’-ACG CGT GAT CAG CRA AAG CAG G-3’) and Superscript III First Strand Synthesis SuperMix (Invitrogen, Carlsbad, CA, USA), following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Human hPSCs cultured on MEFs were harvested using collagenase IV as big aggregates and settled 3 times in washing media (DMEM [Thermo Fisher Scientific], 5% Newborn Calf Serum [Sigma], 1X Penicillin & Streptomycin [Thermo Fisher Scientific]), then strained by an 80μm strainer ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was prepared from tissue samples (3-5 mg) or cell pellets (2.5×105 cells) using the Ambion PureLink RNA minikit (Life Technologies, Carlsbad, CA, USA) as directed by the supplier ...
-
bioRxiv - Microbiology 2022Quote: ... and Viral genomic terminal sequences were determined using commercial 5’ and 3’ RACE (rapid amplification of cDNA ends) kits (Invitrogen, Waltham, MA, USA). The PCR products were gel-purified using the Gel Extraction Kit (OMEGA Bio-Tec Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... were mixed with 1 pmol of AS primer 1 (5’-TGGGTGGTACTTAAGTTCGG-3’: complementary to nts 476-495 of A3G RNA) labeled with Vic (Life Technologies SAS, France). The mixture was heated at 90°C for 2 min and placed on ice for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed in PBS 3 times for 5 minutes and mounted with ProLong Gold Antifade Mountant (#P36930, Thermo Fisher Scientific, Waltham, MA). Histological evaluation was performed single blinded ...
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 PBS washes were performed and then 2 hours of incubation in CY-5 goat anti-rabbit (1:1000, Invitrogen, ThermoFisher Scientific, A10523) diluted in 2%NGS-PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA fragment was labeled with 5-(3-aminoallyl)dUTP by nick translation according to the manufacturer’s protocol (Ares DNA labeling kit, Molecular Probes, Eugene, OR, USA), and the incorporated dUTPs were labeled with amino-reactive Alexa Fluor 647 dye by using the same Ares DNA labeling kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Dishes were washed with PBS 5 times for 3 min each before applying donkey anti-mouse Alexa Fluor 568 secondary antibodies (A10037, Invitrogen; 1:2000 diluted) and Alexa Fluor 647 phalloidin (A22287 ...
-
bioRxiv - Neuroscience 2023Quote: ... and gravitational sedimentation by washing 3 times in wash media composed of DMEM/F12 supplemented with 5% fetal bovine serum (Thermo Fisher: 10082– 147) and 1000 U/ml penicillin/streptomycin ...
-
bioRxiv - Genetics 2024Quote: ... followed by the addition of 300 ng of predesigned sgRNA targeting exon 3 region of the XPC gene with a crRNA sequence (5’AGGCACACCATCTGAAGAGA3’) (Thermofisher Scientific, Massachusetts, USA). The sgRNA and Cas9 mixture was incubated for 10 minutes at room temperature to assemble and form the ribonucleoprotein complex ...
-
bioRxiv - Immunology 2024Quote: ... Primers were designed with 3’ BamHI and 5’ KpnI sites flanking each sequence and the fragment amplified using Phusion™ High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Purified PCR product was digested with BamHI-HF and KpnI-HF (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA fragment was labeled with 5-(3-aminoallyl)dUTP by nick translation according to the manufacturer’s protocol (Ares DNA labeling kit, Molecular Probes, Eugene, OR, USA), and the incorporated dUTPs were labeled with amino-reactive Alexa Fluor 647 dye by using the same Ares DNA labeling kit.
-
bioRxiv - Cell Biology 2024Quote: ... 2.0µM Template Switching Oligo (TSO) (5′-Biotin-AGAGACAGATTGCGCAATGNNNNNNNNrGrGrG-3′; IDT) and 2U µl−1 of Maxima H Minus reverse transcriptase (Thermo Fisher Scientific, #EP0752). Plates were quickly centrifuged before incubation at 42°C for 90min ...
-
bioRxiv - Cell Biology 2024Quote: ... and membranes were washed 3×5 minutes in 1X TBS-T before being developed using Pierce SuperSignal West Pico PLUS (Thermo Scientific, cat: 34580) (β-catenin ...
-
bioRxiv - Plant Biology 2022Quote: ... the specific entry clones described above (TRB1-3, 5 in pDONR207 and TRB4 in pENTR223) were used in LR Clonase™ II (Thermo Fisher Scientific) reactions to create the pGWB6 (N-terminal GFP fusion under the 35S promoter ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.5 µl of both forward and reverse primers (5 µM) were run on the QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). The primers used in this study were ...
-
bioRxiv - Genetics 2023Quote: ... RNA was extracted in pools of 10 from 3-5 days old females randomly selected and unexposed to any insecticides using Arcturus PicoPure RNA isolation kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Both real-time PCR reactions were performed using Universal MasterMix and TaqMan MGB probes with 5’FAM and a 3’ nonfluorescent quencher (NFQ, Thermo Fisher, CA. USA). The obtained cycle threshold values were converted to an arbitrary amount by using standard curves from a serial dilution of a pooled sample made from all samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for 3 days at a density of 5 × 104 cells per well in a 96-well tissue culture plate (Thermo Fisher, Nunclon delta). The media was then replaced with fresh PMA-free media and the cells were left to rest for 24 h before the infection protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA was extracted from the SGs from SGs of 3-5-day-old fifth-instar larvae using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Biochemistry 2024Quote: ... to visualize CaSR-containing cells and for 5 minutes with 1:1000 TO-PRO-3 iodide (#T3605, Thermo Fisher Scientific, Waltham, MA, USA) to visualize permeable cells ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were then rinsed 3 times for 5 minutes in PBS and mounted on ColorFrost Plus slides (Fisher Scientific, Ottawa, Ontario, Canada) using Fluoromount-G (Southern Biotech ...
-
bioRxiv - Cancer Biology 2022Quote: ... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133; V5 tag, ThermoFisher #R960-25 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Lens apoptosis was determined in the same SAG and control DMSO embryos as heart eye measurements were made by staining with 5 μg/ml Lysotracker Red DND 99 (Invitrogen) for 30 min in the dark as described previously (Ma et al. ...
-
bioRxiv - Physiology 2024Quote: ... 5% horse serum (GibcoTM; #16050) and primocin (100 µg/ml, Invitrogen) at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 μl/ml near-infrared live/dead fixable viability dye (Thermo Fisher, L94375) for 30 minutes on wet ice ...
-
bioRxiv - Neuroscience 2021Quote: ... Selection was applied 3 days post-nucleofection using 0.5 mg/ml puromycin (Life Technologies). Selection was maintained for 10 days until stable colonies appeared ...
-
bioRxiv - Biochemistry 2020Quote: ... grown to 3 million cells/ml in Lonza Insect XPRESS (Fisher Scientific, BW12-730Q), were infected with P3 viral stocks at ∼10 mL/L ...
-
bioRxiv - Genomics 2022Quote: ... Cells were selected 3 days after transfection with puromycin (2µg/mL) (Thermo Fisher Scientific) for a duration of 5 days ...
-
bioRxiv - Neuroscience 2019Quote: ... and then dialyzed in 3-12 ml dialysis cassettes 10,000 MWCO (Thermo Scientific #66810) against 1L of 4M guanidine HCL (diluted from 6M stock ...
-
bioRxiv - Biochemistry 2021Quote: ... After adding 3 μL of 10 U/mL PI-PLC (P6466, Thermo Fisher Scientific) diluted in buffer B ...
-
bioRxiv - Immunology 2021Quote: ... spleens from mice were collected in 3 ml of RPMI 1640 (Invitrogen, Carlsbad, CA) supplemented with 5% heat inactivated FBS and smashed between frosted ends of two glass slides ...
-
bioRxiv - Immunology 2020Quote: ... lungs and livers were perfused with 3-10 mL of liver perfusion medium (Gibco) until tissues cleared ...
-
bioRxiv - Cell Biology 2022Quote: ... transfected cells were selected with 3 μg/ml puromycin (#A11138-03, Thermo Fisher Scientific) 48 h post-transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 μl RNase A (20-40 mg/ml) (Thermo Fisher Scientific, Waltham, MA, USA) and 15 μl proteinase K (10 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... Cells were grown to 3×106 cells/mL and transfected using Expifectamine (Life Technologies) with 1 μg of plasmid per mL of culture media ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed once with PBS and incubated with 3 mL of TrypLE (Gibco) for 3-5 min or until cells lifted off from the plates with gentle tapping ...
-
bioRxiv - Biochemistry 2024Quote: ... and transfected at a density of 3 × 106 cells/mL using ExpiFectamine293 (Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... primary human foreskin fibroblasts (HFFs) in 3 mL of DMEM (Thermo Fisher Scientific, 11965118) +10% FBS ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL of 50 mg/mL BSA (Cat#AM2616, Thermo Fisher Scientific, Waltham, USA), 10 µL of 400 U/µL T4 DNA Ligase (Cat#M0202 ...
-
bioRxiv - Cell Biology 2022Quote: ... transfected cells were selected with 3 μg/ml puromycin (#A11138-03, Thermo Fisher Scientific) 48 hours post-transfection ...
-
bioRxiv - Genomics 2023Quote: ... use 10 μL for 2-3 ml of blood) or EDTA (0.5M EDTA, Gibco, cat ...