Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for 6 Chloro 2 3 diphenylimidazo 1 2 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... or b) B27 1:50 (Gibco), 5 µg/mL Insulin (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 x B-27 (Thermo Fisher), 2 mM L-Glutamine (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% B-27 (Thermo Scientific #17504044), Glutamax ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific). Tissue was minced into smaller pieces prior to mechanical and enzymatic dissociation as indicated previously(Llamazares-Prada et al ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific). Upon reception ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific). Exemplary samples of the different areas of the lung piece were collected for subsequent histological analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific). Tubes were closed tightly ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific). Stained cells were added to Falcon 5 mL polystyrene tubes with 40 µm cell strainer caps (Neolab Migge) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (Fisher Scientific).
-
bioRxiv - Neuroscience 2019Quote: ... lamin B (Invitrogen, PIPA519468, 1:1000), and PECAM (NB100-2284 ...
-
bioRxiv - Immunology 2021Quote: ... 1% amphotericin B (Fisher Scientific, #15290018) and Pronase from Streptomyces griseus (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% amphotericin B (Gibco, USA) in a Steri Cycle 370 incubator (Thermo-Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 x B-27 (Life Technologies), 1 x N-2 (Life Technologies) ...
-
bioRxiv - Genetics 2022Quote: ... and B-27 (1:50, Gibco). After culturing for 7-10 days according to the design of the experiment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 % AmpB (Amphotericin B, Gibco, UK) and 10 μL WST-1 (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1:50 B-27 (Gibco, 17504044), and 100 units/mL penicillin/streptomycin (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... B-Actin (1:5000) (Invitrogen, USA); SnaiI ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5-μg·ml-1 amphotericin B (Gibco), 1× insulin-transferrin-selenium (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1:50 B-27 (Gibco, 17504044), and 1:100 pen strep ...
-
bioRxiv - Neuroscience 2023Quote: ... 1× B-27a (Gibco, 17504-044), 5 µg/ml insulin (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 1× amphotericin B (Gibco-Invitrogen). Cell culture media of CCL-9.1 was also used as maintenance medium by infection with MHV.
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 1× amphotericin B (Gibco-Invitrogen). Cell culture media of CCL-9.1 was also used as maintenance medium by infection with MHV.
-
bioRxiv - Immunology 2024Quote: ... + 1:50 B-27 Supplement (Gibco) + 50 ng/ml human EGF +100 ng/ml human IGF1 (Stemcell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... + 1:50 B-27 Supplement (Gibco) + 1:100 N-2 Supplement (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... 1× B-27 Supplement (Life Technologies), 1.25 mM N-acetylcysteine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mM of 4-(2-hydroxyethyl)-1-piperazine-1-ethanesulfonic acid (HEPES) (Gibco) and 1 ng/mL of human bFGF (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 1 - 2 μg ml-1 poly(dA:dT) (InvivoGen) (transfected with Lipofectamine 2000, Invitrogen), 100 µM imiquimod (R837 ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2% B27 and 1% L-glutamine and 1% Pen-Strep (Life Technologies). Cultured neurons were fed with 250 μl NB+ media on days in vitro (DIV ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... supplemented with 1/2 x N2 and 1 x B27 (Thermo Fisher Scientific), 1% Penicillin/Streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) (Invitrogen, cat.#15630080), CellMask membrane dye (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... at a 1:1 ratio and recombinant human IL-2 (Peprotech, ThermoFisher Scientific), and expanded in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with KIF-encoding plasmid and empty vector pcDNA3.1 (+) (1 µg total DNA) using 2 µl Lipofectamine 3000 Reagent and 2 µl P3000 (Thermo Fisher Scientific). hTERT-RPE1 cells stably expressing SMO-tRFP were transfected a day after seeding and IMCD3 cells expressing mCherry-Arl13b were reverse transfected at the time of seeding ...
-
bioRxiv - Neuroscience 2020Quote: ... A square glass window (2 mm x 2 mm) of No 1 cover glass (0.13 to 0.17 mm thick, Thermo Fisher Scientific, USA) was placed over the craniotomy and the edges were sealed with cyanoacrylate glue (3M ...
-
bioRxiv - Immunology 2020Quote: ... 25mM HEPES (2(−4-(2-hydroxyethyl)-1-piperanzinyl) ethansulfonacid) and supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, ThermoFisher Scientific), 10.000 U/mL (v/v ...
-
bioRxiv - Genomics 2023Quote: ... were added into a fresh 2 mL microcentrifuge tube and washed with 1 mL of NPB using a DynaMag-2 magnet (#12321; ThermoFisher Scientific) for a total of three washes (1 min incubation/each) ...
-
bioRxiv - Cell Biology 2023Quote: ... First, cell detachment was attained using a cell dissociation solution (at 2:2:1 ratio, Cell Dissociation Buffer (Thermo Fisher Scientific): RPMI 1640 ...
-
bioRxiv - Genomics 2023Quote: ... total RNA from young livers were spiked with 2 µl of a 1:100 dilution of ERCC Ex-fold Mix 1 while that from old livers were spiked with 2 µl of 1:100 dilution of ERCC Ex-fold Mix 2 (Thermo Fisher). Exfold ERCC spike-ins are provided in two mixes ...
-
bioRxiv - Cancer Biology 2023Quote: ... were mixed in a 3:1 with sample buffer (NuPAGE™ LDS Sample Buffer (4X) + 2-Mercaptoethanol in 2:1) and loaded onto a precast Gel (NuPAGE™ 4-12% Bis-Tris Gel, Invitrogen). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were incubated overnight at 4 °C (Table 2) or 2 hours at room temperature and then washed prior to Alexa fluorochrome-conjugated secondary antibodies (1:500, ThermoFisher Scientific) incubation for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were incubated overnight at 4 °C (Table 2) or 2 hours at room temperature and then washed prior to Alexa fluorochrome-conjugated secondary antibodies (1:500, ThermoFisher Scientific) incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... was pre-complexed at 5µg/mL with PE-conjugated goat anti-Human IgG diluted at 1/100e (Supplementary Table 2) for 2 h at room temperature in PBS CaCl2 MgCl2 (14040133, ThermoFisher Scientific). 200 000 T-ALL cells pre-stained with cell surface markers were incubated with this complexe ...
-
bioRxiv - Neuroscience 2024Quote: Intracellular ROS in BV-2 cells was measured by incubating cells with 1 µM cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen, D399) at 37°C for 30 min.
-
bioRxiv - Biochemistry 2020Quote: ... Cells were mounted on ProLong Gold with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA, USA) and imaged using a Delta-Vision II microscope system with an Olympus IX-71 inverted microscope using a 100x objective A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Slides were mounted in ProLong™ Gold Antifade Mountant containing 4’,6’-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Images were acquired at 100x magnification using a Nikon Eclipse Ti fluorescence microscope fitted with a Hamamatsu C11440 digital camera ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole and were embedded with ProLong Gold mounting medium (Life Technologies). ImageJ/Fiji software (National Institutes of Health ...
-
bioRxiv - Neuroscience 2020Quote: Human sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) and coverslips were mounted using Prolong Gold (Invitrogen) for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were mounted in ProLong Gold antifade reagent supplemented with 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes). Conventional immunocytochemical staining was done to quantify the activated PAK1 and actin in oAβ and IPA-3 treated cells using phospho-PAK1 (Thr423)/PAK2 (Thr402 ...