Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 7935 citations for IL 12RB1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... or with ‘anti-inflammatory’ compound IL-4 (10ng/ml) (Life Technologies). Compounds were resuspended in sterile water and were added to DMEM for different lengths of time stated in each experiment.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... IL-1β and TNFα were analyzed using ELISA kits (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Q Exactive Plus mass spectrometers (Thermo Fisher Scientific, Rockford, IL, USA) coupled with an Ultimate 3000 UPLC system (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Enhanced Chemiluminiscent (ECL) reagents were from Thermo Scientific (Rockford, IL, USA), and Hybond™ and Hyperfilm™ were from GE Healthcare Amersham (Piscataway ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and nicotine tartrate salt (Acros Organics, Thermo Fisher Scientific, Chicago, IL) were mixed with tap water to the concentrations reported for each experiment ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and nicotine tartrate salt (Acros Organics, Thermo Fisher Scientific, Chicago, IL) were mixed with tap water to the concentrations reported for each experiment ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 1μM of cAMP (Thermo Fisher Scientific, Rockford, IL, USA) and 10 ng/mL of BDNF ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and CXCL8 were determined using the ProcartaPlex kit (Invitrogen) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Anti IL-1 alpha (Thermo Fisher Scientific; Cat.# 11-7118-81).
-
bioRxiv - Cell Biology 2022Quote: ... Phagocytosis of alexa fluor 594 conjugated zymosan bioparticles (ThermoFisher, Rockford, IL) was performed as described in (Rijal et al. ...
-
bioRxiv - Immunology 2022Quote: ... and IL-10 Mouse Uncoated ELISA Kit (88-7105-86, Invitrogen), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The peptides were synthesized and provided by Thermo Scientific (Rockford, IL).
-
bioRxiv - Microbiology 2022Quote: ... lyophilized protein transfection reagent [PTR] (Pro-Ject, Thermo Scientific, Rockford, IL) was reconstituted in 1 ml of HEPES 100 μm ...
-
bioRxiv - Neuroscience 2020Quote: ... The bands were visualized by enhanced chemiluminescence (Thermo Scientific, IL, USA). Finally ...
-
bioRxiv - Immunology 2020Quote: The IL-33 Quantikine ELISA kit was purchased from Applied Biosystems and manufacturer instructions were followed ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 ug/ml of interleukin-2 (IL-2; Gibco BRL) in complete RPMI 1640 containing 2mM L-glutamine ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor® 488 Phalloidin (Invitrogen, ThermoFisher Scientific, Rockford IL, USA) was used to stain cytoskeleton and 1 μM Dapi (sc-3598 ...
-
bioRxiv - Immunology 2020Quote: IL-13 was measured using an eBioscience ELISA kit (Thermo Scientific) using the manufacturer’s instructions ...